4045 разделить на 5 в столбик: 4045:5 как решить столбиком — Школьные Знания.com
By: Date: 21.06.1970 Categories: Разное

Содержание

Исследовательская работа на тему: «Тайна снежных кристаллов»

Муниципальное казённое образовательное учреждение

Мало-Томская СОШ

Секция: география

Тайна снежных кристаллов Исследовательская работа

Автор: Бисерова Екатерина

6 класс

Руководитель: учитель географии

Базылева Елена Анатольевна

д. Малая-Томка 2016

Оглавление:

Введение……………………………………………………. ……………………3

Основная часть

Глава I. Теоретическое исследование

1.1. Что такое снежный кристалл……………………………………………… 5

1.2. Где и как рождается снежинка……………………………………………. 6

1.3. Какие бывают снежинки ……………………………………………………8

1.4.От чего зависит форма снежинки ………………………………………….11

1.5. Звук снега……………………………………………………………………13

1.6. Кто изучал снежинки……………………………………………………….14

Глава II. Практическое исследование

2.1. Ведение дневника наблюдений за погодой……………………………….18

2.2. Метод фотографирования…………………………………………………..21

2.3. Опыты «Как вырастить снежинку в домашних условиях»…………………………………………………………………………21

Заключение………………………………………………………………………23

Литература ………………………………………………………………………..25

Приложение …………………………………………………………………….26

Введение

Актуальность исследования:

Мы живем в Сибири и знаем о зиме не понаслышке. У нас с вами есть, как минимум один повод гордиться этим: в отличие от жителей жарких стран мы можем любоваться снежинками в естественных условиях. Я очень люблю зиму. Для меня это самое удивительное время года. Вся природа в сказочном убранстве: в белом кружеве деревья, в серебристом инее крыши домов, окна в морозных узорах. Только зимой бывает снег – это уникальнейшее явление природы. Я часто рассматриваю снежинки, и каждый раз восхищаясь этой красотой, задаю себе вопросы. Что такое снежинки? Какие они бывают? Как образуются? Почему снег скрепит под ногами? При изучении темы «Атмосферные осадки» учитель географии сказал, что в природе нет двух одинаковых снежинок, все они разные, но в то же время все имеют строго шестиугольную форму. Но как, может такое быть? В интернете я прочитала, что в одном кубическом метре снега находится примерно 350 миллионов снежинок, неужели среди такого количества не найдется двух одинаковых? И почему не бывает пятиугольных или восьмиугольных снежинок? На все эти вопросы мне необходимо было получить ответ, и я решила провести своё исследование. Гипотеза: Я предполагаю, если снежинки такие разные, значит на их форму, возможно, влияют разные условия, при которых они образуются. Так была определена цель моего исследования — узнать, какие формы образуют снежинки, а также причины, условия и процесс их образования.

Для достижения цели, надо было решить следующие задачи:

1) понаблюдать за снегопадами и выявить все возможные формы снежинок,

2) зафиксировать результаты наблюдений и создать свою классификацию форм,

3) проанализировать наблюдения и сделать выводы,

4) изучить научную информацию по теме, подтвердить или опровергнуть выводы, сделанные мною,

5) выявить почему, как и где формируются снежинки,

6) описать разнообразие форм и существующие их классификации,

7) определить условия образования такого разнообразия снежинок,

8) доказать, что двух одинаковых снежинок не существует,

9) познакомиться с историей изучения снежинок,

10) выявить способы получения искусственных снежинок, провести опыты по их получению,

11) сделать выводы, подтвердить или опровергнуть их научными знаниями.

Объект исследования – Снежинка.

Предмет исследования – форма снежинки и процесс её образования. Методы исследования:

  • Наблюдение;

  • фиксация и анализ наблюдений;

  • фотографирование;

  • измерение;

  • работа с информационными источниками;

  • эксперимент;

  • анализ полученных данных.

Практическая значимость моего исследования состоит в том, что оно может быть использовано школьниками для повышения образовательного уровня, а также учителем географии для объяснения тем и проведения занимательного урока по теме «Атмосферные осадки».

1.1.Что такое снежный кристалл?

Снежинка — это снежный или ледяной кристалл. Мы знаем, что все вещества состоят их мельчайших частиц — атомов. Кристаллические тела (кристаллы) — это твердые тела, в которых атомы расположены в определенном порядке. Название этого порядка — кристаллическая решетка. Это геометрический образ, который помогает представить расположение атомов в кристаллах.

Из энциклопедии я узнала, что атомы соединяются в молекулы. Молекула — самая маленькая частица вещества, имеющая все его свойства. Молекула воды (льда, пара) состоит из двух веществ: кислорода и водорода, причем атомов водорода два, а кислорода — один.

В кристаллической решётке льда его молекулы расположены в виде шестиугольника, в углах которого расположены атомы кислорода (красные сферы), между ними – атомы водорода (белые сферы)

Именно такое строение кристалла льда формирует шестиугольную снежинку и никогда и нигде в природе вы не встретите её пяти- или восьмилучевую.

1.2. Где и как рождается снежинка?

Жизнь снежинки начинается с момента, когда в облаке водяного пара при понижении температуры образуются кристаллические частицы льда. Центром кристаллизации могут быть пылинки, любые твердые частицы, но в любом случае эти льдинки, размером меньше десятой доли миллиметра, уже имеют кристаллическую решетку. Как я уже выяснила, кристаллы льда имеют форму шестигранника. Именно из-за этого большинство снежинок имеют форму шестиконечной звезды.

Дальше этот кристаллик начинает расти. У него могут начать расти лучи, или у этих лучей начинают появляться отростки, или — наоборот, снежинка начинает расти в толщину.

Как именно в данный момент будет расти снежинка, зависит от текущих условий вокруг снежинки: влажность, температура, давление, форма снежинки. И даже самые минимальные изменения этих параметров могут изменить ход роста снежинки.

Условия постоянно меняются. И получается, что снежинка то растет в ширину, то у нее отрастают лучи. В холодную и сухую погоду снежинки вообще растут в высоту, а не в ширину, и получаются шестиугольные столбики, а непривычные нам разлапистые звезды.

Направления роста изменений снежинки всегда обусловлены тем, что кристаллы льда шестиугольные. Два кристаллика не могут соединиться углом, они всегда присоединяются друг к другу гранью. Поэтому лучи всегда растут в шесть сторон, а от луча может отходить «ветка» только под углом 60 или 120 градусов.

Поскольку каждая снежинка живет своей жизнью и внешние условия у них у всех хотя бы минимально, но отличаются, то все снежинки разные. Не бывает абсолютно одинаковых снежинок — каждая из них проходит через разные сочетания влажности, давления и температуры.

1.3. Какие бывают снежинки.

Существует такое многообразие снежинок. Например, Кеннет Либрехт — автор самой большой и разнообразной коллекции снежинок — говорит: «Все снежинки разные, и их размещение по группам (классификация) — это во многом вопрос личных предпочтений».

В 1951 году Международная Комиссия по Снегу и Льду приняла классификацию твёрдых осадков. Согласно ей все снежные кристаллы можно разделить на следующие группы: звёздчатые дендриты, пластинки, столбцы, иглы, пространственные дендриты, столбцы с наконечником и неправильные формы. К ним добавились еще три вида обледеневших осадков: мелкая снежная крупка, ледяная крупка и град.

Классификация снежинок по схожему типу:

Призмы — бывают, как 6-угольные пластинки, так и тонкие столбики с 6-угольным сечением. У призм крошечные размеры, их почти не видно невооруженным глазом. Грани призмы, очень часто украшают различные сложные узоры.

Иглы — тонкие и длинные снежные кристаллы, они образуются при температуре примерно -5 градусов.
При рассмотрении они похожи на маленькие светлые волоски.

Дендриты — или древоподобные, имеют ярко выраженные разветвляющиеся тонкие лучи. Чаще это крупные кристаллы, их можно увидеть невооруженным глазом. Максимальный размер дендрита может достигать 30 см в диаметре.

Двойные пластинки — у данного типа, столбики с наконечниками имеют короткую вертикальную часть. Пластинки растут очень быстро, от водяных паров одна из низ заслоняет вторую и в результате вырастает более крупной по размеру.

Полые столбики — внутри столбиков с шестиугольным сечением, бывает образуются полости. Интересно, что форма полостей симметрична относительно центра кристалла. Необходимо большое увеличение, чтобы рассмотреть полости в маленьких снежинках.

Пространственные дендриты — бывает так, что из микроскопической капли начинает расти несколько снежных кристаллов в различных направлениях. И после они могут приобрести сложную форму. Такие сращенные кристаллы могут распадаться на несколько простых снежинок.

Звездоподобные снежинки — такие снежинки широко распространены. Это тонкие пластинчатые кристаллы, в виде звезд с шестью лучами. Чаще они украшены симметричными различными узорами. Такие снежинки появляются при —2 °С или при —15 °С.

Но существует множество других, более сложных классификаций снежных кристаллов. Одна из них насчитывает 35 типов снежинок, другая — 41, а самая сложная классификация — 80 различных видов снежных кристаллов. Кеннет Либбрехт — автор самой большой и разнообразной коллекции снежинок — говорит: «Все снежинки разные, и их размещение по группам (классификация) — это во многом вопрос личных предпочтений».

Круповидная снежинка — падающие снежинки сталкиваются с сильным потоком воздуха, мелкие капельки воды из которого со всех сторон намерзают на них, при этом снежинки из плоских превращаются в белые или матовые шарики, диаметром от 1 до 5 мм.

Классификация снежинок Укихиро Накайя, которая насчитывает 41 тип:

1.4. От чего зависит форма снежинки

От маршрута, по которому снежинка путешествует с неба на землю, прямо зависит её облик. В районах с разной влажностью, температурой и давлением грани и лучи растут по-разному. 

Кристаллики-призмы образуются в высоких перистых облаках при температурах ниже — 35ºС, далее они падают вниз сквозь более теплые облака. Если температура в облаке в пределах:

от — 3 до 0 ºС, то образуются плоские шестиугольники,

от — 5 до — 3 ºС формируются игольчатые кристаллы,

от — 8 до — 5 ºС образуются столбики — призмы,

от — 12 до — 8 ºС вновь появляются плоские шестиугольники,

от — 16 до — 12 ºС возникают первые звездчатые снежинки,

от — 22 до — 16 ºС вновь появляются столбики – призмы.

При дальнейшем снижении температуры образуются снежинки всех типов.

По мере того, как снежинка падает, она растёт, становится тяжелее, а форма её продолжает изменяться. Если снежинки подлетают к земле в тёплую погоду, от 0 до –5 ºС, они подтаивают, покрываются инеем, форма их сглаживается или вовсе теряется. Если стоит хороший мороз — приблизительно –20°C, он позволяет снежинкам расти уверенно, до самой земли сохраняя остроту лучей и граней.

При дальнейшем понижении температуры воздух становится более сухим, осадки не образуются. Но в приполярных районах, где температура редко поднимается выше –40°C, а воздух очень сухой, всё равно идёт снег. При этом снежинки представляют собой крохотные шестиугольные призмы с идеально ровными гранями, без малейшего сглаживания углов.

В странах Балтии и в центральных областях России, например, высокая влажность и часто идет снег в виде сложной формы разветвленных снежинок. Вероятность увидеть крупные снежинки существенно возрастает вблизи водоёмов: испарения с озёр и водохранилищ — это отличный строительный материал. И конечно же, крайне желательно отсутствие сильного ветра, иначе большие снежинки будут сталкиваться друг с другом и ломаться. Если снежинка при падении вращается, как волчок, то её форма идеально симметрична, если же она падает боком или её закручивает в восходящих потоках, то форма будет несимметричной, лучи не одинаковыми.

Самая крупная когда-либо засвидетельствованная снежинка имела диаметр в 12 см. Обычно же снежинки имеют около 5 мм в диаметре при массе 0,0004г и средней толщине — 0,08 мм. Снежинки состоят на 95% из воздуха, что обуславливает низкую плотность и сравнительно медленную скорость падения (0,9 км/ч).

Поскольку каждая снежинка живет своей жизнью и внешние условия у них у всех хотя бы минимально, но отличаются, то все снежинки разные. Не бывает абсолютно одинаковых снежинок — каждая из них проходит через разные сочетания влажности, давления и температуры. Итак, форма снежинки — это естественная запись ее маршрута по разным облакам с различной температурой и влажностью. 

1.5.Звук снега

Свежему снегу в морозный день всегда сопутствует веселый хруст под ногами. Это не что иное, как звук ломающихся кристаллов. Никто не способен расслышать, как ломается одна снежинка, но тысячи маленьких кристалликов — солидный оркестр. Чем ниже опускается столбик термометра, тем более твёрдыми и хрупкими становятся снежинки и тем выше становится тон хруста под ногами. Набравшись опыта, можно использовать это свойство снега, чтобы определять температуру на слух. На Крайнем Севере снег бывает настолько твердым, что топор при ударе по нему звенит, словно ударили по железу.

1.6. Кто изучал снежинки

Снежинки, уникальные и неповторимые, во все времена интересовали ученых, и некоторые из них посвятили исследованию ледяных кристаллов всю свою жизнь.

Одним из первых ученых, задумавшихся о структуре снега, был немецкий математик и астроном Иоганн Кеплер (1571–1630).

В 1611 году он опубликовал короткий трактат «Новогодний подарок, или о шестиугольных снежинках», который можно назвать первой научной работой, посвященной снежинкам.

«Поскольку всякий раз, когда начинает идти снег, первые снежинки имеют форму шестиугольной звезды, то на то должна быть определенная причина. Ибо если это случайность, то почему не бывает пятиугольных или семиугольных снежинок, почему всегда падают шестиугольные, если только они от соударений не утрачивают форму, не слипаются во множестве, а падают редко и порознь?»

(Иоганн Кеплер, Новогодний подарок, или о шестиугольных снежинках, 1611)

Рене Декарт (1596–1650), французский философ и математик, стал первым, кто подробно описал форму снежинок. Интересно, что в записях Декарта упомянуты даже очень редкие формы ледяных кристаллов, например, увенчанные столбики.

«Это были маленькие пластинки льда, плоские, очень гладкие и прозрачные, толщиной примерно с лист плотной бумаги… идеально сложенные в шестиугольники, стороны которых были столь прямыми, а углы столь равными… человеку невозможно создать что-либо подобное.»

(Рене Декарт, 1635)

Изобретение микроскопа позволило английскому физику Роберту Гуку (1635–1703) опубликовать в 1665 году работу под названием «Микрография», в которой ученый описал все, что мог исследовать с помощью нового инструмента. В издание вошло множество рисунков снежинок, впервые показавших всю сложность и замысловатость снежных кристаллов.

Изучая снежинки с помощью микроскопа, я обнаружил… чем сильнее увеличение, тем более несимметричными они кажутся. Но эту несимметричность можно приписать таянию или повреждению во время падения, но никак не дефекту Природы.

(Роберт Гук, Микрография, 1665)

Одним из первых известных фотографов снежинок стал Андрей Андреевич Сигсон (1840–1907), российский фотохудожник из Рыбинска. Всего ему удалось сделать фотографии около 200 различных форм ледяных кристаллов. Для этого фотограф использовал специальную технологию: снежинки ловились на сетку из шелковинок, затем с помощью микроскопа увеличивались в 15–24 раза. Чтобы хрупкие кристаллы не растаяли во время фотографирования, Сигсон охлаждал руки и дышал через специальную трубку.

Снежинки Сигсона

Американским же пионером фотографии снежинок стал Уилсон Бентли (1865–1931). За всю жизнь он сделал около 5000 снимков снежинок. 2500 из них были опубликованы в 1931 году в книге «Снежные кристаллы».

Снежинки Бентли, 1902 год

Укихиро Накайя (1900–1962), профессор Университета в Хоккайдо  — первый ученый, который систематизировал знания о ледяных кристаллах. Накайя не только фотографировал снежинки, но и научился выращивать их в лаборатории. Он первый выявил зависимость их формы от температуры и влажности окружающей среды.
Результатом изысканий ученого стала книга «Снежные кристаллы: природные и искусственные», выпущенная в 1954 году. В городе Кага, расположенном на западном берегу острова Хонсю, существует основанный Укихиро Накайя Музей снега и льда, носящий теперь его имя, символично выстроен в виде трех шестиугольников. В музее хранятся первые снимки и машина для получения снежинок. 

«Снежные кристаллы — это письма, посланные нам с небес, написанные тайными иероглифами».

(Укихиро Накайя, документальный фильм «Снежные кристаллы», 1939)

Глава II. Практическое исследование

2.1. Ведение дневника наблюдений за погодой

Из информационных источников я узнала, какие факторы влияют на формирование снежинки: это — влажность, температура и давление. Чтобы убедиться на собственном опыте, я решила вести «Дневник наблюдений», где ежедневно фиксировала облачность, температуру воздуха, определённую по термометру за окном, атмосферное давление, скорость и направление ветра, значения которых можно найти в Интернете. Здесь же, при наличии снегопада, я зарисовывала форму падающих снежинок и характеризовала их дополнительно.

Дневник наблюдений в виде таблицы находится в Приложении 1 в конце работы. Для наблюдения я выбрала февраль месяц, т.к. для Сибири он является одним из снежных месяцев. Наблюдения велись с 29 января по 29 февраля. Вот какие выводы удалось сделать на основе данных из «Дневника наблюдений»:

1) Несмотря на то, что февраль считается снежным месяцем снег шел не так часто, всего 16 дней. 2) Снегопад начинался всегда при изменении хотя бы одного из параметров: направления или силы ветра, влажности воздуха, атмосферного давления, температуры воздуха. Это могло быть сочетанием нескольких факторов — двух или трёх.

3) При очень низких температурах воздуха (- 25ºС и ниже) образовывались только мелкие снежинки ( не более 1 мм в диаметре) и без разветвлений на лучах. Я назвала их «морскими ежами».

4) Большое многообразие форм снежинок образовывалось при более высоких температурах воздуха (- 20ºС и выше).

5) Все наблюдаемые мной снежинки я разделила на три класса: дендриты, пластинки и крупка.

МОЯ КЛАССИФИКАЦИЯ СНЕЖИНОК

1. Дендриты

(на греческом — дерево) — это разветвлённые кристаллы. Так я назвала все разветвлённые снежинки, все они были шестилучевые, но с разной степенью разветвления. Я определила пять групп:

а)

Сильноразветвлённые дендриты — всегда крупные снежинки, до 10мм в диаметре, с очень разветвлёнными лучами и чётко выраженным кристаллическим центром. Образовывались при разных погодных условиях и часто слипались в «хлопья».

б)

Среднеразветвлённые дендриты — снежинки различного размера, от 1мм до 5 мм в диаметре, со среднеразветвлёнными лучами, менее плотным центром. Образовывались при различных погодных условиях.

в)

Слаборазветвлённые дендриты — всегда мелкие снежинки, 1 — 2 мм в диаметре, со слаборазветвлёнными лучами, но хорошо заметным, маленьким, но плотным центром. Образовывались при низких температурах воздуха ( — 18ºС, — 20ºС) и северном ветре со скоростью 1м/с, 2м/с, при различных прочих природных условиях.

г)

Дендриты «морские ежи» — всегда мелкие снежинки, самые крупные из них не более 1мм, лучи всегда голые, тонкие, центр заметен. Условия образования различны.

д)

Дендриты «пластинки» — крупные (до 5 мм в диаметре) шестилучевые снежинки пластинчатого облика. Всегда отдельные, не слипаются. Сильно сверкают на свету. Образовывались при различных условиях.

В наблюдении за дендритами проявилась ещё одна закономерность: чем мельче размер снежинки, тем менее разветвлены её лучи и, наоборот, чем крупнее снежинка, тем более развитую форму она имеет.

2. Пластинки

Такие снежинки выпали только один раз, при температуре воздуха — 15 и — 20ºС. Они были маленькие, не более 1мм. Шестиугольные, но без лучей, некоторые из них опускались в виде обломков, но углы шестиугольника прослеживались чётко. Несмотря, на малый размер, пластинки сильно сверкали на свету.

3. Крупка

Образовывалась однократно, в последний день февраля, размером от 1 до 2 мм в диаметре, образовалась при температуре -5ºС.

2.2. Метод фотографирования и наблюдения.

Чтобы разобраться, какие формы образуют снежинки, я решила их фотографировать. «Соберу побольше снимков, — думала я, — рассортирую их по видам, там, глядишь и одинаковые попадутся.»

Как только начинался снегопад, я быстро одевалась и выскакивала на улицу с фотоаппаратом и с лупой. Фотографировала снежинки, пролетающие по воздуху на фоне тёмного забора, падающие на варежку, на стекле автомобиля, стоящего во дворе. Я увеличивала и уменьшала разрешение снимков, включала и выключала вспышку. При помощи лупы разглядывала и изучала формы снежинок.

Просто на улице, как оказалось, снежинку снимать сложно, много факторов, мешающих этому: ветер, солнце внезапно спрячется за тучи или, наоборот, засветит кадр и т.д. Да, и дышать нельзя, а то снежинка может растаять! Но все-таки несколько удачных кадров у меня получилось, где очертания снежинок на фото четкие и можно определить их форму на снимках. (см. Приложение 2).

2.3. Опыты «Как вырастить снежинку в домашних условиях»

Опыт №1. В поисках необходимого мне материала в Интернете я посмотрела документальный фильм ВВС «Великая тайна воды» об информационной памяти воды. В фильме авторы давали «слушать» музыку различного характера воде, находящейся в сосуде, молекулы воды составляли слабоустойчивые структуры — кластеры, которые способны были запоминать информацию, которая их окружала, затем замораживали каплю такой воды и, если музыка была классической, получали кристаллы в виде шестилучевых снежинок.

Я предположила, что тоже смогу таким образом получить снежинки, После «прослушивания» произведений Бетховена палочкой переношу каплю воды из кружки на крышку, замораживаю в морозильной камере холодильника и вместо планируемой снежинки получаю замороженную каплю воды. Вывод: да, молекулы воды могут объединяться в кластеры за счёт водородных связей, но связи эти в жидкой фазе живут не более пикосекунды (10–12 с), так что память у воды «девичья».

Опыт №2. Я решила, что поймаю снежинку во время снегопада, растоплю её, а потом вновь заморожу. Тогда, возможно, подчиняясь законам строения своей кристаллической решётки, она возродится в первоначальном виде. Помещаю в морозильную камеру холодильника пойманную на улице и растаявшую дома снежинку и получаю вместо планируемой возродившейся снежинки каплю замёрзшей воды. Вывод: как мы уже выяснили, снежинки образуются не из воды, а из водяного пара.

Опыт №3. Зная, что снежинка появляется из мельчайших частиц пара и образуется при разной температуре и влажности воздуха, я решила создать подходящие условия, для выращивания снежинки.

Для этого я взяла: 1. Чистое стекло. 2. Емкость для воды. Я налила в емкость небольшое количество воды и накрыла её стеклом

Все это я поместила в морозильную камеру. Стала ждать.

Замерзшую в емкости воду я периодически заменяла на свежую (жидкую). Она начала испаряться, оседать и замерзать (кристаллизоваться) на стекле.

За 1 сутки на стекле вырос только тонкий слой морозного узора. Снежинка так и не выросла. Вывод: Значит, для того, чтобы выросла снежинка в домашних условиях, недостаточно влажного воздуха и низкой температуры в морозильной камере.

Опыт №4. Тогда я решила провести ещё один опыт, о котором прочитала в интернете. Для этого я взяла: железную кастрюлю, поваренную соль и большой растолченный кусок льда. Положила в кастрюлю три стакана ледяной крошки, затем стакан соли, потом снова три стакана льда, закрыла крышкой кастрюлю и вынесла на веранду. Через некоторое время водяные капельки, находящиеся в воздухе, покрыли внутреннюю сторону крышки, превратившись в маленькие ледяные кристаллы, и постепенно вся она оделась слоем инея. Этот переход молекул воды из газообразного состояния в твердое (лед), минуя жидкое (воду), называется десублимацией. Вывод: конечно, иней – это не снежинка, но все же снежные кристаллы мне удалось вырастить.

Заключение.

В результате проведённого мною исследования, я сделала следующие выводы.

1) Я предполагала, что существуют в природе не только шестилучевые, но и какие-нибудь замысловатые, треугольные или квадратные снежинки. Но предположение мое не подтвердилось, подчиняясь законам строения кристаллической решётки льда, снежинки всегда вырастают только шестиугольными.

2) Для того чтобы фотографировать снежинки качественно, необходим опыт и профессиональное оборудование, не случайно некоторые исследователи посвятили этому занятию всю свою жизнь.

3) В течении 32 дней я наблюдала за погодой и вела «Дневник наблюдений». В результате родилась моя собственная классификация форм снежинок, состоящая из трёх групп. Группу «Дендриты» я разделила на пять видов. Все снежинки зарисованы. Мне удалось выявить ряд зависимостей образования форм снежинок от внешних условий их образования.

4) В период анализа данных из «Дневника наблюдений» возник ряд вопросов, ответы на которые я искала в книгах, фильмах, Интернете. Я узнала, где и как начинают формироваться снежинки, какие условия влияют на образование их форм, каково разнообразие этих форм. Таким образом, цель моего исследования достигнута.

5) Дополнительно к этим знаниям я выяснила, что в большинстве своём снежинки не симметричны и нашла доказательство отсутствия в природе двух одинаковых снежинок.

6) Желание самой вырастить шестилучевую дендритную снежинку заставило меня провести четыре опыта. Снежинку мне вырастить не удалось, но понять, что наука — это серьёзно, случилось!

Сейчас я по-другому смотрю на падающий снег, поймаю на варежку снежинку и, словно здороваюсь с ней, как со старой знакомой. Смотрю на её лучи и понимаю, что ей довелось пережить. Сейчас я понимаю, что снежинка — это уникальное явление природы. Узор каждой из них является единственным и неповторимым. Ну, разве это не чудо?! Природа лишний раз доказала, что нет творца талантливее, чем она сама.

Литература

  1. Большая Российская энциклопедия: Отв.ред.С.Л.Кравец.Т.23. – М:Большая российская энциклопедия, 2013 – 767с.

  2. Всё обо всем: Популярная энциклопедия для детей.Т.4 – М: «Ключ –С», «Слово», 1995 – 446с.

  3. Ситников В.П. Кто есть кто в мире природы. М:АСТ:СЛОВО: Полиграфиздат, 2011 – 320с.

  4. Советский энциклопедический словарь/Научно-редакционный совет: А.М.Прохоров. – М: «Советская энциклопедия», 1981 – 1600с.

  5. Чижевский А.Е. Я познаю мир. Детская энциклопедия. Экология. Москва. Издательство АСТ, 1999 – 289с.

  6. Энциклопедический словарь юного физика. Составитель В.А.Чуянов. М., Издательство: Педагогика, 1984 – 352с.

  7. Интернет-ресурсы:

[http://www.nkj.ru/archive/articles/4013]

[http://www.nkj.ru/archive/articles/4045]

[http://www.o8ode.ru/article/krie/klaccifikacia_cneginok.htm]

[http://www.o8ode.ru/article/krie/cneginki.htm]

[https://ru.wikipedia.org/wiki/%D0%A1%D0%BD%D0%B5%D0%B6%D0%B8%D0%BD%D0%BA%D0%B0]

[http://www.voprosy-kak-i-pochemu.ru/kak-obrazuyutsya-snezhinki]

[http://class-fizika.narod.ru/pog13.htm]

[http://online-docfilm.com/other/science/39-velikaya-tayna-vody.html]

Mathway | Популярные задачи




1 Оценить с использованием заданного значения квадратный корень 50
2 Оценить с использованием заданного значения квадратный корень 45
3 Вычислить 5+5
4 Вычислить 7*7
5 Разложить на простые множители 24
6 Преобразовать в смешанную дробь 52/6
7 Преобразовать в смешанную дробь 93/8
8 Преобразовать в смешанную дробь 34/5
9 График y=x+1
10 Оценить с использованием заданного значения квадратный корень 128
11 Найти площадь поверхности сфера (3)
12 Вычислить 54-6÷2+6
13 График y=-2x
14 Вычислить 8*8
15 Преобразовать в десятичную форму 5/9
16 Оценить с использованием заданного значения квадратный корень 180
17 График y=2
18 Преобразовать в смешанную дробь 7/8
19 Вычислить 9*9
20 Risolvere per C C=5/9*(F-32)
21 Упростить 1/3+1 1/12
22 График y=x+4
23 График y=-3
24 График x+y=3
25 График x=5
26 Вычислить 6*6
27 Вычислить 2*2
28 Вычислить 4*4
29 Вычислить 1/2+(2/3)÷(3/4)-(4/5*5/6)
30 Вычислить 1/3+13/12
31 Вычислить 5*5
32 Risolvere per d 2d=5v(o)-vr
33 Преобразовать в смешанную дробь 3/7
34 График y=-2
35 Определить наклон y=6
36 Перевести в процентное соотношение 9
37 График y=2x+2
38 График y=2x-4
39 График x=-3
40 Решить, используя свойство квадратного корня x^2+5x+6=0
41 Преобразовать в смешанную дробь 1/6
42 Преобразовать в десятичную форму 9%
43 Risolvere per n 12n-24=14n+28
44 Вычислить 16*4
45 Упростить кубический корень 125
46 Преобразовать в упрощенную дробь 43%
47 График x=1
48 График y=6
49 График y=-7
50 График y=4x+2
51 Определить наклон y=7
52 График y=3x+4
53 График y=x+5
54 График 3x+2y=6
55 Решить, используя свойство квадратного корня x^2-5x+6=0
56 Решить, используя свойство квадратного корня x^2-6x+5=0
57 Решить, используя свойство квадратного корня x^2-9=0
58 Оценить с использованием заданного значения квадратный корень 192
59 Оценить с использованием заданного значения квадратный корень 25/36
60 Разложить на простые множители 14
61 Преобразовать в смешанную дробь 7/10
62 Risolvere per a (-5a)/2=75
63 Упростить x
64 Вычислить 6*4
65 Вычислить 6+6
66 Вычислить -3-5
67 Вычислить -2-2
68 Упростить квадратный корень 1
69 Упростить квадратный корень 4
70 Найти обратную величину 1/3
71 Преобразовать в смешанную дробь 11/20
72 Преобразовать в смешанную дробь 7/9
73 Найти НОК 11 , 13 , 5 , 15 , 14 , , , ,
74 Решить, используя свойство квадратного корня x^2-3x-10=0
75 Решить, используя свойство квадратного корня x^2+2x-8=0
76 График 3x+4y=12
77 График 3x-2y=6
78 График y=-x-2
79 График y=3x+7
80 Определить, является ли полиномом 2x+2
81 График y=2x-6
82 График y=2x-7
83 График y=2x-2
84 График y=-2x+1
85 График y=-3x+4
86 График y=-3x+2
87 График y=x-4
88 Вычислить (4/3)÷(7/2)
89 График 2x-3y=6
90 График x+2y=4
91 График x=7
92 График x-y=5
93 Решить, используя свойство квадратного корня x^2+3x-10=0
94 Решить, используя свойство квадратного корня x^2-2x-3=0
95 Найти площадь поверхности конус (12)(9)
96 Преобразовать в смешанную дробь 3/10
97 Преобразовать в смешанную дробь 7/20
98 Преобразовать в смешанную дробь 2/8
99 Risolvere per w V=lwh
100 Упростить 6/(5m)+3/(7m^2)

ПНШ 4 класс. Математика. Учебник № 2, с. 103

Алгоритмы вычисления столбиком (повторение)

Ответы к с. 103

338. Выполни деление столбиком числа 25844 на число 14.
Что должно получиться в результате, если делимое разделить на значение частного?
Сделай проверку правильности 
выполнения деления с помощью деления.
Что должно получиться в результате, если значение частного умножить на делитель?
Сделай проверку правильности выполнения деления с помощью умножения.

 25844|14
   14     |1846
 _118
   112
     _64
       56
       _84
         84
           0

Делитель.

 25844|1846
   1846  |14
   _7384
     7384
           0

Делимое.

  ×1846
       14
 + 7384
 1846
 25844

339. Вычисли значение каждого из следующих выражений. Все вычисления выполни столбиком.
45368 – 25689 + 135897 – 96734
1268 • 39 : 13 • 25
25687 • 3 – 123456 : 3 + 89635
(368957 + 243651) – (890653 -546321)
(256537 – 254149) • (895364 – 895315)
(456872 – (626356 – 170124)) • 18 : (100000 – 99991)

45368 – 25689 + 135897 – 96734 = 58842
1268 • 39 : 13 • 25 = 95100
25687 • 3 – 123456 : 3 + 89635 = 125544
(368957 + 243651) – (890653 – 546321) = 268276
(256537 – 254149) • (895364 – 895315) = 117012
(456872 – (626356 – 170124)) • 18 : (100000 – 99991) = 1280

340. Выполни деление столбиком числа 51034 на число 17, используя сокращённую форму записи.
Сделай проверку правильности выполнения деления с помощью умножения.

 51034|17    
   51      |3002
       _34
         34
           0

    ×3002
        17
 +21014
  3002   
  51034

341. Составь задание на вычитание столбиком и предложи соседу по парте решить его.

Выполни вычитание столбиком для чисел 654321 и 456132.

_654321
  456132
  198189

Ответы к заданиям. Математика 4 класс. Учебник. Часть 2. Чекин А.Л. 2014 г.

Математика. 4 класс. Чекин А.Л.

4.9
/
5
(
148

голосов
)

Доминирование плавающих растений как стабильное состояние

Реферат

Нашествие матов из свободно плавающих растений — одна из наиболее серьезных угроз для функционирования и биоразнообразия пресноводных экосистем, начиная от прудов и канав умеренного пояса и заканчивая тропическими озерами. Темные бескислородные условия под толстым покровом плавучих растений оставляют мало возможностей для жизни животных или растений и могут иметь серьезные негативные последствия для рыболовства и судоходства в тропических озерах. Здесь мы демонстрируем, что доминирование плавающих растений может быть самостабилизирующимся состоянием экосистемы, что может объяснить его печально известное постоянство во многих ситуациях.Наши результаты, основанные на экспериментах, полевых данных и моделях, представляют доказательства альтернативных областей притяжения в экосистемах. Следствием наших выводов является то, что обогащение питательными веществами снижает устойчивость пресноводных систем к переходу к доминированию плавучих растений. С другой стороны, наши результаты также предполагают, что один разовый урожай плавающих растений может вызвать постоянный переход к альтернативному состоянию, в котором преобладают укорененные, погруженные формы роста.

Плотные маты из свободно плавающих растений оказывают неблагоприятное воздействие на пресноводные экосистемы, поскольку они создают аноксические условия, которые сильно сокращают биомассу и разнообразие животных (1).Вторжения интродуцированных экзотических видов частично ответственны за усиление доминирования плавающих растений. Проблемы, вызываемые Eichhornia crassipes , Pistia stratiotes и Salvinia Molesta , печально известны: они затрудняют производство и судоходство рыбы в тропических регионах по всему миру (2–4). Однако эвтрофикация, вероятно, также способствовала распространению свободно плавающих растений. В зонах умеренного климата известно, что густые заросли ряски (Lemnaceae) и небольших плавающих водных папоротников (Azollaceae) являются признаком высокого содержания питательных веществ в небольших водоемах, таких как пруды и каналы (5, 6).Как и в случае с тропическими растениями, темные и бескислородные условия под толстым покровом ряски оставляют мало возможностей для жизни животных или растений (1).

Зависимость свободно плавающих растений от высоких концентраций питательных веществ в воде является очевидным следствием их формы роста. У них нет прямого доступа к отложению питательных веществ, и у них большая часть поверхности листа подвергается воздействию атмосферы, а не воды, тем самым уменьшая возможность поглощения другими питательными веществами, кроме углерода, через их листья.Напротив, укоренившиеся погруженные макрофиты могут поглощать большую часть своих питательных веществ из отложений (7, 8), а также эффективно использовать свои побеги для поглощения питательных веществ из водной толщи (9, 10). Хотя плавучие растения, очевидно, являются лучшими конкурентами для света, погруженные в воду растения могут влиять на рост свободно плавающих растений за счет сокращения доступных питательных веществ в толще воды. Конкуренция, вероятно, будет особенно сильной за азот. Хотя доступность фосфора в водной толще может быть снижена из-за поглощения погруженными макрофитами (11), многие исследования показывают неизменные или даже повышенные уровни орто-P после увеличения покрытия макрофитами (12-15).Напротив, концентрации азота в толще воды затопленных насаждений часто ниже уровней обнаружения (15, 16).

Методы

Модель.

Асимметрия в конкуренции между свободно плавающими и укорененными погруженными растениями имеет три основных особенности: ( i ) плавающие растения имеют преимущество в отношении света, тогда как ( ii ) погруженные растения могут расти при более низких концентрациях питательных веществ в толще воды и ( iii ) они снижают содержание питательных веществ в толще воды до более низкого уровня.Мы строим простую модель для изучения возможных последствий этой специфической асимметрии: 1 2 Изменения во времени биомассы плавающих растений, F, , и погруженных растений, S, , моделируются как функция их максимальной скорости роста, r f и r s , измененные ограничением питательных веществ и света, а также их потери, l f и l s , вызванные такими процессами, как дыхание и различные факторы смертности .Ограничение питательных веществ — это функция насыщения общей концентрации неорганического азота, n , в водной толще, которая, как предполагается, является убывающей функцией биомассы растений: 3, где максимальная концентрация ( N ) в отсутствие растений зависит от на загрузку системы питательными веществами, а параметры q s и q f представляют влияние погруженных и плавучих растений на концентрацию азота в толще воды.Ограничение света формулируется просто (17): где 1/ a f и 1/ a s — это плотности плавающих и погруженных растений, при которых скорость их роста уменьшается на 50% из-за внутривидовой конкуренции за свет. В дополнение к этой внутривидовой конкуренции, облучение погруженных растений уменьшается за счет ослабления света в толще воды ( W ) и затенения плавающими растениями, масштабируемыми параметром b.

Значения по умолчанию и размеры параметров приведены в Таблице 1. Значение по умолчанию для ч с равно 0, чтобы имитировать ситуацию, в которой поступления питательных веществ из отложений достаточно, чтобы рост растений в воде практически не зависел от концентрации питательных веществ. в толще воды. Концентрация полунасыщения, h f , для плавающих растений выбрана в середине диапазона значений, приведенных в литературе по росту ряски (18, 19).Значение по умолчанию для q s подразумевает, что погруженная растительность с 20 г сухого веса m -2 может снизить концентрацию азота в воде на 50% (15), тогда как плавающие растения оказывают меньшее воздействие ( q f < q s ). Параметры самозатенения для плавающих и погруженных растений a f и a s установлены одинаковыми и настроены таким образом, что максимальная биомасса при отсутствии каких-либо ограничений по питательным веществам приближается к реалистичному значению.Поскольку, в отличие от случая самозатенения, в котором вся биомасса плавающих растений способствует затенению всех погруженных растений, мы выбрали соответствующий параметр b больше, чем коэффициент внутривидовой конкуренции a . Обратите внимание, что значения параметров по умолчанию являются лишь отправной точкой, поскольку мы будем систематически анализировать чувствительность модели к значениям параметров.

Таблица 1

Значения по умолчанию и размеры параметров и переменных модели

Результаты

Анализ этой модели показывает, что конкуренция может привести к альтернативным стабильным состояниям при различных условиях (рис.1). При низких концентрациях питательных веществ единственным стабильным состоянием является равновесие с погруженными растениями (E s ). С повышением уровня питательных веществ в качестве альтернативного равновесия появляется монокультура плавающих растений (E f ). Однако состояние погруженных растений (E s ) также остается (локально) стабильным. Следовательно, при условии, что не произойдет никаких серьезных нарушений, в системе будет оставаться доминирующая часть погруженных растений до тех пор, пока при следующем бифуркации плавающие растения не начнут появляться вместе с погруженными растениями в устойчивой смеси (E m ).С увеличением питательной нагрузки доля плавающих растений в смеси постепенно увеличивается, пока не будет достигнута точка бифуркации ( f м ), при которой смешанное равновесие исчезнет и система переместится (рис.1, двойная стрелка вверх) к единственное оставшееся стабильное состояние — монокультура плавучих растений. Если впоследствии концентрация питательных веществ уменьшится, система не вернется к смешанному равновесию по тому же пути. Вместо этого он остается на верхней ветви складчатой ​​кривой с преобладанием плавающих растений до тех пор, пока не будет достигнута точка бифуркации ( x f ), где заканчивается стабильность монокультуры плавающих растений, и система снова переключается на погруженное растение. доминируемое государство.

Рисунок 1

Влияние нагрузки питательными веществами на равновесную биомассу плавающих растений ( a ) и погруженных растений ( b ). Стрелки указывают направление изменения, если система находится вне равновесия. Они показывают, что пунктирное равновесие (седло) неустойчиво. Вертикальные переходы с двойными стрелками соответствуют катастрофическим сдвигам к альтернативному равновесию.

Надежность.

Значения параметров по умолчанию выбраны таким образом, чтобы они могли разумно имитировать определенные полевые ситуации.Однако виды растений и их окружающая среда сильно различаются, и очевидно, что для представления различных полевых условий необходимы разные наборы значений параметров или формулировки моделей. Здесь мы анализируем, как на результаты влияют различные предположения о конкуренции за питательные вещества и свет, а также принимая другую формулировку модели.

Меняющаяся конкуренция за питательные вещества.

Мы предположили, что погруженные растения уменьшают доступность питательных веществ в водной толще в большей степени, чем плавающие растения ( q s > q f ), и что, по существу, рост погруженных растений не зависит от по питательным веществам в водной толще ( ч с = 0).Ослабление первого предположения имеет несколько эффектов (рис. 2). Если воздействие погруженных растений на питательные вещества умеренно, но в достаточной мере снижено, система с преобладанием плавающих растений сначала переключается на смешанное равновесие, а не непосредственно в состояние чистого погруженного растения в ответ на уменьшение количества питательных веществ. Во-вторых, гистерезис становится менее выраженным по мере того, как расстояние между бифуркациями x f и f m становится меньше. Действительно, если предположить, что влияние погруженных растений на питательные вещества такое же, как у плавающих растений, гистерезис полностью исчезнет (рис.2 б ).

Рисунок 2

Влияние нагрузки питательными веществами на равновесную биомассу плавающих растений, как на рис.3 a , но для умеренного ( a : q s = 0,025) и малого ( b : q с = 0,005) уменьшение содержания питательных веществ в толще воды за счет погруженных растений.

Более систематический способ анализа такого влияния значений параметров на поведение модели — это выполнение бифуркационного анализа (20).Идея в нашем случае состоит в том, чтобы построить график критических уровней питательных веществ, при которых происходят бифуркации, в зависимости от интересующего параметра (рис. 3). Первый график (рис.3 a ) показывает эффект изменения параметра ( q s ), который представляет влияние погруженных растений на питательные вещества (обратите внимание, что на рисунках 1 и 2 представлено поведение модели на разных горизонтальных участках). сечения: q с = 0,075, 0,025 и 0,005). Главное отметить, что гистерезис становится меньше, если влияние погруженных растений на уровни питательных веществ ( q s ) уменьшается и в конечном итоге исчезает ниже точки, где две кривые бифуркации ( x s и ф м ) встречаются.Точно так же гистерезис становится меньше, если зависимость роста погруженных растений от питательных веществ ( h s ) увеличивается (рис. 3 b ). Другие бифуркационные анализы (не показаны) показывают, что уменьшение q f имеет качественно те же эффекты, что и увеличение q s , тогда как увеличение h f эквивалентно уменьшению h s . В заключение, асимметрия конкуренции за питательные вещества ( q s > q f и h f > h s ) является существенной причиной гистерезиса.

Рисунок 3

Бифуркационные графики, показывающие влияние параметров q s , h s , W и b ( a , b , c и d соответственно) на загрузку питательных веществ ( N ), при которой различные бифуркации ( x m , x f и f m ) в модели происходить.Линии бифуркации очерчивают участки на плоскости параметров с различными наборами равновесий. Доминирование плавающих растений (F), доминирование погруженных растений (S) или стабильное сочетание этих групп (M) может иметь место как уникальное равновесие, но в некоторых разделах также как одно из двух альтернативных равновесий (обозначенных как S / F, F / M, или S / M). Все изображенные бифуркации рассчитаны с помощью программы LOCBIF (41).

Меняющаяся конкуренция за свет.

Конкуренция за свет — еще один важный компонент нашей модели.Хотя мы не моделировали фитопланктон в явном виде, прежде всего следует отметить, что вероятность того, что погруженные макрофиты вытеснят свободно плавающие растения, уменьшаются, если ослабление света в толще воды (представленное параметром W ) становится больше (рис. с ). Таким образом, для более глубоких и / или более мутных озер прогнозируется меньшая вероятность преобладания затопленной растительности и гистерезис.

Асимметрия световой конкуренции между двумя типами растений представлена ​​в наших настройках параметров по умолчанию, предполагая, что эффект затенения ( b ) плавающих растений на погруженных растениях вдвое сильнее, чем внутривидовые эффекты затенения ( a ).Обоснование этого состоит в том, что в среднем только 50% биомассы погруженных растений отбрасывает тень на данный погруженный лист растения, тогда как вся биомасса плавающих растений вносит свой вклад в тень на погруженном листе. Эта логика сначала кажется разумной, но верна только в маловероятном случае, когда фотосинтез линейно уменьшается с затенением биомассы. Уменьшение b , чтобы ослабить это предположение, перемещает гистерезис к более высоким уровням питательных веществ (рис. 3 d ). Однако нелегко оценить, какое значение будет наиболее реалистичным для b .На самом деле, есть более фундаментальные проблемы с формулировкой легкой конкуренции. То, как фотосинтез уменьшается с затенением биомассы, зависит от ослабления света в биомассе растений и реакции фотосинтеза на свет.

Смена модели.

Чтобы проверить, является ли предсказанный гистерезис артефактом упрощающих предположений, таких как простая формулировка конкуренции света и отсутствие сезонности и воспроизводства, мы сформулировали детально проработанную индивидуальную пространственно явную имитационную модель для конкуренции между укорененными погруженными растениями и ряской.Эта модель является расширением более ранней модели роста погруженных растений (21), и ее характеристики и анализ будут подробно представлены в другом месте. Модель описывает сезонную динамику роста водных растений в регионах с умеренным климатом, включая перезимовку в период покоя и отрастание весной. Хотя конкуренция питательных веществ формулируется просто, как в нашей простой модели, легкая конкуренция описывается гораздо более реалистичным образом в имитационной модели. Облучение следует за синусоидальной волной как в течение года, так и в течение дневного цикла.Фотосинтез данной части растения зависит от света in situ и расстояния от ткани до верхушки растения; последнее происходит из-за снижения активности по мере старения тканей. In situ Свет на любом участке зависит от затенения растительной биомассой в более высоких слоях и мутности в водном слое. Реакция этой сложной модели на загрузку питательными веществами (рис.4) характеризуется гистерезисом, который не включает смешанное состояние, но в остальном очень похож на гистерезис, обнаруженный в простой модели (рис.1). Этот результат показывает, что гистерезис, по крайней мере, не является артефактом простой формулировки конкуренции света, используемой в простой модели, или отсутствия сезонности в простой модели.

Рисунок 4

Гистерезис доминирования плавучих растений, предсказанный на основе сложной сезонной имитационной модели конкуренции между плавучими и погруженными заводами.

Доказательства

Конкурсные эксперименты.

Чтобы проверить, действительно ли альтернативное равновесие может быть результатом конкуренции между двумя формами роста, мы провели серию контролируемых экспериментов, в которых позволили соревноваться затопленному растению Elodea nuttallii и плавающей ряске Lemna gibba .Перед экспериментами все растения акклиматизировались в течение 14 дней в бедной питательными веществами (0,5 мг на литр N, 0,08 мг на литр P) воде при одинаковых температурах и световом режиме. Впоследствии растениям разрешили соревноваться в течение 57 дней в 8-литровых контейнерах. Начальный уровень питательных веществ был одинаковым для всех резервуаров (5 мг на литр азота, 0,83 мг на литр фосфора). Температура воды поддерживалась на уровне 23-25 ​​° C, и резервуары подвергались ежедневному циклу 16 часов темноты / 8 часов света (180 мкмоль · м −2 · с −1 ).Параллельные эксперименты были начаты с четырех различных начальных условий, каждое из которых представлено двумя повторяющимися аквариумами. Если существует только одно равновесие, ожидается, что такие эксперименты будут сходиться к нему, тогда как они, как ожидается, закончатся в любом из альтернативных состояний равновесия, если таковые существуют (рис. 5). Наши повторные эксперименты явно заканчивались в альтернативных состояниях, в зависимости от начальной биомассы обоих видов (рис. 6), тем самым подтверждая гипотезу альтернативного равновесия. Подобные эксперименты, проведенные с различными уровнями питательных веществ, показали, что Lemna с большей вероятностью будет превосходить Elodea при более высоких уровнях питательных веществ (не показано), что также соответствует прогнозам модели.

Рисунок 5

( a ) Если существуют два стабильных состояния, траектории моделирования с нашей моделью заканчиваются в любом из двух состояний, в зависимости от начальных условий. ( b ) Напротив, траектории моделирования сходятся к одной и той же точке, если существует единственное равновесие. Последние симуляции выполняются с h s = 0,2, r s = 1,2 и другими параметрами при значениях по умолчанию (см. Таблицу 1).

Рисунок 6

Траектории роста в экспериментах по конкуренции погруженного растения ( Elodea ) и плавающего растения ( Lemna ) стремятся к разным конечным состояниям в зависимости от начальной плотности растений. Все эксперименты проводились в одинаковых условиях. Биомасса наносится на график для всех экспериментов на 1-й, 23-й и 57-й день. Пунктирные эллипсы указывают SD повторных экспериментов.

Образцы доминирования ряски в голландских канавах.

Чтобы проверить, можно ли найти доказательства альтернативных стабильных состояний в полевых условиях, мы проанализировали обширный набор данных переписей растительности и качества воды из 641 голландской канавы. Обычно растительность неизбирательно удаляется из таких канав один или два раза в год, чтобы предотвратить их засорение растительностью. Очевидно, что биомасса растительности и, следовательно, конкуренция неуклонно возрастают с (не зарегистрированного) момента удаления. Поэтому мы произвольно разделили набор данных на подмножество с редкой растительностью (общее покрытие всех таксонов <50%), подмножество с густой растительностью (общее покрытие> 50%) и подмножество с очень густой растительностью (общее покрытие> 80%).В соответствии с теорией, частотное распределение свободно плавающих растений при более высокой плотности растительности было бимодальным (рис. 7). Кроме того, как и предполагалось, укрытие поплавков отрицательно коррелировало с численностью подводных растений, а поплавки показали положительную корреляцию с уровнями питательных веществ в водной толще, тогда как погруженные растения отрицательно связаны с уровнями питательных веществ (Таблица 2). Напротив, в подмножестве канав с редкой растительностью (Таблица 3) корреляция между формами роста и концентрацией питательных веществ менее выражена, а численность плавающих и погруженных растений положительно коррелирована, как можно было бы ожидать в фазе возобновления роста после удаления растительности, когда биомасса отражает время восстановления после очистки, а не конкуренцию между формами роста (рис.5 а ).

Рисунок 7

Бимодальное частотное распределение свободно плавающих растений в группе из 158 густо заросших (общий растительный покров> 80%) голландских канав.

Таблица 2

Соотношение рангов копейщика: густая растительность

Таблица 3

Соотношение рангов копейщика: редкая растительность

Сдвиг между плавучими и погруженными растениями в африканском озере.

В совершенно ином масштабе тенденция к альтернативным стабильным состояниям иллюстрируется историей озера Кариба, самого большого искусственного озера в Африке, образовавшегося в результате перекрытия реки Замбези в 1958 году.Во время заливки произошел популяционный взрыв плавающих Salvinia Molesta и других плавучих растений (22–24). Плавающая растительность оставалась в изобилии до десятилетия спустя, когда произошел взрыв бентической растительности и мидий, который заблокировал большое количество питательных веществ (24). Покрытие сальвинии быстро упало до <5% в 1973 г. и до <1% с 1980 г. (23). В 1996–1999 гг. Произошло новое увеличение плавающей растительности, на этот раз Eichhornia crassipes .Скорее всего, сдвиги между альтернативными состояниями были вызваны амплитудой колебаний уровня воды. Сильные колебания благоприятствуют плавающим растениям, поскольку они подавляют погружение растений (25) и увеличивают поступление питательных веществ из затопленной земли (23, 26). История этого озера снова демонстрирует тенденцию к доминированию погруженных или плавучих растений, причем последнее связано с высокими уровнями питательных веществ и повышенной смертностью погруженных растений, в данном случае из-за колебаний уровня воды.

Обсуждение

Хотя альтернативные стабильные состояния считаются важными для понимания и управления экосистемами, начиная от коралловых рифов (27) и систем открытого океана (28) до засушливых земель (29) и лесов (30), их присутствие в полевых условиях было чрезвычайно трудным. чтобы доказать. Обычно сильные случаи требуют комбинации подходов (31, 32). Это был подход в данном исследовании.

Модели составляют основу нашего анализа.Однако, несмотря на то, что имитационная модель на индивидуальной основе содержит больше деталей, чем простая модель, многие механизмы, которые могут повлиять на конкуренцию, до сих пор не включены. Например, аноксия под плавающими грядками может ускорить вымирание погруженных растений. Кроме того, рост видов ряски может подавляться при более высоких значениях pH (33–35), которые могут возникать в результате фотосинтеза в затопленных зарослях сорняков. Хотя эти конкретные механизмы будут скорее усиливать, чем ослаблять гистерезис, другие механизмы, которые мы не рассматривали, потенциально могут работать противоположным образом.

Важным фактором, который мы не рассмотрели, является роль фитопланктона. В мелководных озерах умеренного климата затопленные растения уступают фитопланктону при более высоких уровнях питательных веществ, и состояние с преобладанием фитопланктона и преобладание погруженных растений, по-видимому, представляют собой альтернативные аттракторы (25, 36–38). Таким образом, важный вопрос заключается в том, будут ли погруженные растения заменены плавучими растениями или фитопланктоном при высокой загрузке питательными веществами. Очевидно, что плавучие растения находятся в лучшем положении для конкуренции за свет.Следовательно, логично ожидать, что плавающие растения в конечном итоге станут доминирующими, когда количество питательных веществ не ограничено. Хотя это действительно может иметь место в тропических озерах (2), прудах и канавах умеренного пояса (5), свободно плавающие растения никогда не становятся доминирующими в более крупных озерах умеренного пояса. Наиболее вероятное объяснение состоит в том, что небольшие ряски и другие свободно плавающие растения, встречающиеся в регионах с умеренным климатом, просто выбрасываются на берег в незащищенных водах, ограничивая их распространение в защищенных местах.Напротив, более крупные ростовые формы свободно плавающих растений, которые могут массово развиваться в тропических озерах, по-видимому, выживают в гораздо более открытых условиях (2). Очевидно, что разработка действительно общей основы для предсказания того, какие условия приводят к преобладанию плавающих растений, фитопланктона или подводных растений, остается серьезной проблемой. Между тем, результаты нашего текущего исследования применимы к ситуациям, в которых господству плавающих растений не препятствуют другие факторы, кроме питательных веществ.

В целом, различные линии доказательств, которые мы представляем, кажутся довольно убедительными в пользу гипотезы о том, что конкуренция между плавающими и погруженными растениями может вызывать альтернативные аттракторы.Модельный подход показывает, что эту гипотезу можно надежно вывести из предположений о том, что плавающие растения имеют преимущественную силу для света, тогда как погруженные растения могут расти при более низких концентрациях питательных веществ в толще воды и снижать количество питательных веществ в толще воды до более низких уровней. Эксперименты с контролируемой конкуренцией прямо демонстрируют альтернативные аттракторы в небольшом временном и пространственном масштабе, а модели в голландских канавах и озере Кариба предполагают, что это явление также может иметь значение в полевых условиях.Ни один из этих подходов сам по себе не может рассматриваться как доказательство. Интерпретации моделей, контролируемые эксперименты и модели полей имеют свои особенности (39). Таким образом, наш центральный результат — это просто приближение «истины как пересечения независимой лжи» (40).

Вероятно, наиболее полезные дополнительные свидетельства могут быть получены с помощью крупномасштабных полевых экспериментов. Поскольку конечное состояние системы зависит от начальной биомассы плавучих растений (рис.6 и 7), наши результаты предполагают, что на мелководье, где есть некоторые погруженные растения и не слишком высокий уровень питательных веществ, один урожай плавающих растений может привести к постоянному переключению на доминирование погруженных растений. По прогнозам, критический урожай, необходимый для смены, будет увеличиваться с увеличением уровня питательных веществ. Фактические критические уровни будут различаться в зависимости от экосистемы, но могут быть обнаружены экспериментально. В общем, лучший способ управлять экосистемами с альтернативными стабильными состояниями — повысить устойчивость предпочтительного состояния (32).В переводе на наш случай этот вывод подразумевает, что контроль питательных веществ может быть важной стратегией для снижения риска вторжения местных или экзотических плавающих растений.

  • Получено 5 июня 2002 г.
  • Принято 20 декабря 2002 г.
  • Copyright © 2003, Национальная академия наук

% PDF-1.3
%
6752 0 объект
>
эндобдж
xref
6752 158
0000000016 00000 н.
0000003516 00000 н.
0000003702 00000 п.
0000003760 00000 н.
0000003793 00000 н.
0000003850 00000 н.
0000006366 00000 н.
0000006663 00000 н.
0000006733 00000 н.
0000006832 00000 н.
0000006932 00000 н.
0000007036 00000 н.
0000007093 00000 п.
0000007256 00000 н.
0000007423 00000 н.
0000007528 00000 н.
0000007636 00000 н.
0000007766 00000 н.
0000007896 00000 н.
0000008023 00000 н.
0000008147 00000 н.
0000008272 00000 н.
0000008392 00000 п.
0000008522 00000 н.
0000008647 00000 н.
0000008781 00000 п.
0000008918 00000 н.
0000009063 00000 н.
0000009187 00000 н.
0000009307 00000 н.
0000009473 00000 п.
0000009583 00000 н.
0000009686 00000 н.
0000009806 00000 н.
0000009920 00000 н.
0000010047 00000 п.
0000010210 00000 п.
0000010324 00000 п.
0000010473 00000 п.
0000010640 00000 п.
0000010732 00000 п.
0000010833 00000 п.
0000010951 00000 п.
0000011069 00000 п.
0000011180 00000 п.
0000011291 00000 п.
0000011417 00000 п.
0000011536 00000 п.
0000011657 00000 п.
0000011763 00000 п.
0000011880 00000 п.
0000011997 00000 п.
0000012103 00000 п.
0000012210 00000 п.
0000012324 00000 п.
0000012450 00000 п.
0000012563 00000 п.
0000012681 00000 п.
0000012796 00000 п.
0000012900 00000 п.
0000013001 00000 п.
0000013171 00000 п.
0000013319 00000 п.
0000013420 00000 п.
0000013549 00000 п.
0000013689 00000 п.
0000013818 00000 п.
0000013937 00000 п.
0000014102 00000 п.
0000014263 00000 п.
0000014368 00000 п.
0000014469 00000 п.
0000014586 00000 п.
0000014703 00000 п.
0000014837 00000 п.
0000014958 00000 п.
0000015077 00000 п.
0000015196 00000 п.
0000015311 00000 п.
0000015428 00000 п.
0000015541 00000 п.
0000015639 00000 п.
0000015750 00000 п.
0000015865 00000 п.
0000015983 00000 п.
0000016101 00000 п.
0000016217 00000 п.
0000016330 00000 п.
0000016450 00000 п.
0000016560 00000 п.
0000016676 00000 п.
0000016790 00000 п.
0000016916 00000 п.
0000017027 00000 п.
0000017147 00000 п.
0000017270 00000 п.
0000017386 00000 п.
0000017499 00000 п.
0000017666 00000 п.
0000017786 00000 п.
0000017891 00000 п.
0000018004 00000 п.
0000018131 00000 п.
0000018260 00000 п.
0000018385 00000 п.
0000018514 00000 п.
0000018640 00000 п.
0000018763 00000 п.
0000018893 00000 п.
0000019019 00000 п.
0000019157 00000 п.
0000019285 00000 п.
0000019406 00000 п.
0000019525 00000 п.
0000019651 00000 п.
0000019779 00000 п.
0000019918 00000 п.
0000020045 00000 п.
0000020161 00000 п.
0000020290 00000 н.
0000020411 00000 п.
0000020533 00000 п.
0000020653 00000 п.
0000020746 00000 п.
0000020854 00000 п.
0000020981 00000 п.
0000021110 00000 п.
0000021240 00000 п.
0000021374 00000 п.
0000021514 00000 п.
0000021644 00000 п.
0000021828 00000 п.
0000021902 00000 п.
0000022084 00000 п.
0000022108 00000 п.
0000023369 00000 п.
0000023393 00000 п.
0000024582 00000 п.
0000024606 00000 п.
0000024680 00000 п.
0000025827 00000 н.
0000025851 00000 п.
0000027306 00000 п.
0000027330 00000 н.
0000028693 00000 п.
0000028717 00000 п.
0000028831 00000 п.
0000028949 00000 п.
0000030244 00000 п.
0000030268 00000 п.
0000031415 00000 п.
0000031439 00000 п.
0000032360 00000 п.
0000032440 00000 п.
0000033120 00000 н.
0000034551 00000 п.
0000003893 00000 н.
0000006342 00000 п.
трейлер
]
>>
startxref
0
%% EOF

6753 0 объект
>
эндобдж
6754 0 объект
>
эндобдж
6755 0 объект
[
6756 0 руб.
]
эндобдж
6756 0 объект
>
/ Ж 42 0 Р
>>
эндобдж
6757 0 объект
>
эндобдж
6908 0 объект
>
ручей
H {PSWOnr4PFEt *! AEAT- „

Человеческие гематопоэтические стволовые клетки, редактируемые геномом, фенотипически корректируют Мукополисахаридоз типа I

Конструирование донорной плазмиды AAV

Донорные векторы CCR5 были сконструированы с помощью ПЦР-амплификации ~ 500 п.н. для левого и правого плеч гомологии локус CCR5 из геномной ДНК человека.Последовательности SFFV, PGK, IDUA амплифицировали из плазмид. Праймеры были разработаны с использованием онлайн-инструмента для сборки (NEBuilder, New England Biolabs, Ипсвич, Массачусетс, США) и были заказаны в Integrated DNA Technologies (IDT, Сан-Хосе, Калифорния, США). Фрагменты были собраны Гибсоном в плазмиду pAAV-MCS (Agilent Technologies, Санта-Клара, Калифорния, США).

Производство rAAV

Мы следовали протоколу, о котором ранее сообщалось, с небольшими изменениями 65 . Вкратце, клетки НЕК 293 трансфицируют с помощью двойной плазмидной системы трансфекции: одиночной вспомогательной плазмиды (которая содержит гены rep и cap AAV и специфические вспомогательные гены аденовируса) и плазмиды донорного вектора AAV, содержащей ITR.Через 2 дня клетки лизируют с помощью трех циклов замораживания / оттаивания и остатки клеток удаляют центрифугированием. Вирусные частицы AAV очищают ультрацентрифугированием в градиенте йодиксанола. Векторы получают диализом и стерилизуют фильтрованием. Титры выполняются с использованием цифровой капельной ПЦР. Альтернативно вирусы были амплифицированы и очищены Vigene Biosciences (Роквилл, Мэриленд, США).

Электропорация и трансдукция клеток

sgRNA CCR5 была приобретена у TriLink BioTechnologies (Сан-Диего, Калифорния, США) и ранее сообщалось 22 .SgRNA была химически модифицирована тремя концевыми нуклеотидами на 5′- и 3′-концах, содержащими 2′-O-метил-3′-фосфоротиоат, и очищена с помощью ВЭЖХ. Целевая последовательность геномной sgRNA (PAM выделена жирным шрифтом) была: CCR5: 5′-GCAGCATAGTGAGCCCAGAAGGG-3 ‘. Белок Cas9 был приобретен у Integrated DNA Technologies. РНП образовывали комплекс путем смешивания Cas9 с sgRNA в молярном соотношении 1: 2,5 при комнатной температуре. CD34 + HSPC были подвергнуты электропорации через 2 дня после оттаивания и размножения с использованием Lonza Nucleofector 4D (программа DZ-100) в растворе первичных клеток P3 следующим образом: 10 × 10 6 клеток / мл, 300 мкг / мл белкового комплекса Cas9 с 150 мкг / мл sgRNA в 100 мкл.После электропорации клетки спасали средой при 37 ° C, после чего добавляли rAAV6 (MOI 15000 из 15000 титровали для максимизации эффективности модификации и восстановления клеток). Контрольный образец с имитацией электропорации был включен в большинство экспериментов, в которых клетки подвергали электропорации без Cas9 RNP.

Количественная оценка предполагаемой нецелевой активности гРНК CCR5

Потенциальные нецелевые сайты в геноме человека (hg19) были идентифицированы и ранжированы с использованием недавно разработанной программы биоинформатики COSMID 36 , позволяющей до трех базовых несоответствий без вставок или делеций и два несоответствия оснований со вставленным или удаленным основанием (выпуклость).Сайты с самым высоким рейтингом были дополнительно исследованы. Нецелевую активность в 67 предсказанных локусах измеряли путем глубокого секвенирования в двух биологических повторностях HSPC, происходящих из CB. Биоинформатически предсказанные нецелевые локусы были амплифицированы с помощью двух раундов ПЦР для введения последовательностей адаптера и индекса для платформы Illumina MiSeq. Все ампликоны были нормализованы, объединены и количественно определены с использованием набора для количественного анализа PerfeCTa NGS в соответствии с инструкциями производителя (Quantabio, Беверли, Массачусетс, США). Образцы секвенировали на приборе Illumina MiSeq с использованием считывания парных концов 2 × 250 п.н.INDEL были определены количественно, как описано ранее: 66 . Вкратце, считывания парных концов из MiSeq были отфильтрованы по среднему качеству Phred (Qscore) более 20 и объединены в более длительное однократное считывание из каждой пары с минимальным перекрытием в 30 нуклеотидов с использованием быстрой регулировки длины коротких считываний. Выравнивания с эталонными последовательностями выполняли с использованием выравнивателя Барроуза-Уиллера для каждого штрих-кода, и количественно определяли процент вставок и удалений, содержащих считывания, в пределах окна ± 5 п.н. от прогнозируемых участков разреза.

Измерение вставок в локусе

CCR5 с ddPCR

Геномную ДНК

экстрагировали либо из основной массы, либо из отсортированных популяций с использованием раствора для экстракции ДНК QuickExtract. Для цифровой ПЦР с каплями (ddPCR) капли генерировали на генераторе капель QX200 (Bio-Rad) в соответствии с протоколом производителя. Контрольный анализ HEX, определяющий входное число копий гена CCRL2 , использовали для количественной оценки входного сигнала хромосомы 3. Анализ, разработанный для обнаружения вставок в CCR5 , состоял из: F: 5′-GGG AGG ATT GGG AAG ACA -3 ′, R: 5′-AGG TGT TCA GGA GAA GGA CA-3 ′ и меченого зонда: 5 ′ — FAM / AGC AGG CAT / ZEN / GCT GGG GAT GCG GTG G / 3IABkFQ-3 ′.Эталонный анализ, разработанный для обнаружения геномной последовательности CCRL2 : F: 5′-CCT CCT GGC TGA GAA AAA G-3 ‘, R: 5′-GCT GTA TGA ATC CAG GTC C-3’ и меченый зонд: 5 ′ — HEX / TGT TTC CTC / ZEN / CAG GAT AAG GCA GCT GT / 3IABkFQ-3 ′. Точность этого анализа была установлена ​​с использованием геномной ДНК из моноаллельной колонии (фракция аллелей 50%) в качестве матрицы. Конечная концентрация праймера и зондов составляла 900 нМ и 250 нМ соответственно. Двадцать микролитров реакции ПЦР использовали для образования капель, и 40 мкл капель использовали в следующих условиях ПЦР: 95–10 мин, 45 циклов 94–30 с, 57–30 с и 72 ° –2 мин, завершите с помощью 98–10 мин и 4 ° C до анализа капель.Капли анализировали на устройстве для чтения капель QX200 (Bio-Rad), обнаруживая FAM и HEX-положительные капли. Были включены контрольные образцы с нематричным контролем, геномной ДНК и имитационно обработанными образцами, а также 50% контроль модификации. Данные анализировали с помощью QuantaSoft (Bio-Rad).

Селекция и культивирование HSPC

Человеческие CD34 + HSPC мобилизовали периферическую кровь, приобретенную у AllCells (Аламеда, Калифорния, США), и разморозили в соответствии с инструкциями производителя. CD34 + HSPC были очищены из пуповинной крови, собранной с информированного согласия через Программу Биннса по исследованиям пуповинной крови в Стэнфордском университете, и использованы без замораживания.Вкратце, мононуклеарные клетки выделяли центрифугированием в градиенте плотности с использованием Ficoll Paque Plus. После двух промывок тромбоцитов HSPC были помечены и положительно отобраны с использованием набора CD34 + Microbead Kit Ultrapure (Miltenyi Biotec, Сан-Диего, Калифорния, США) в соответствии с протоколом производителя. Обогащенные клетки окрашивали APC против CD34 человека (клон 561; Biolegend, Сан-Хосе, Калифорния, США), и чистоту образца оценивали на проточном цитометре Accuri C6 (BD Biosciences, Сан-Хосе, Калифорния, США). Клетки культивировали при 37 ° C, 5% CO 2 и 5% O 2 в течение 48 часов перед редактированием гена.Питательная среда состояла из StemSpan SFEM II (Stemcell Technologies, Ванкувер, Канада) с добавлением SCF (100 нг / мл), TPO (100 нг / мл), Flt3-лиганда (100 нг / мл), IL-6 (100 нг / мл). мл), UM171 (35 нМ) и StemRegenin1 (0,75 мкМ).

Анализ колониеобразующих единиц и клональное генотипирование

Клетки по отдельности сортировали в 96-луночные планшеты (Corning), предварительно заполненные 100 мкл метилцеллюлозы (Methocult, StemCell Technologies).

Одиночные клетки YFP +, YFP- и псевдо-обработанные клетки были отсортированы в метилцеллюлозную среду, содержащую SCF, IL3, эритропоэтин и GM-CSF, условия, которые поддерживают рост клеток-предшественников крови: предшественников эритроидов (эритроидные клетки-предшественники) -E, и колониеобразующий элемент-эритроид или CFU-E), предшественники гранулоцитов-макрофагов (CFU-GM) и многопотенциальные клетки-предшественники гранулоцитов, эритроидов, макрофагов, мегакариоцитов (CFU-GEMM).

Через 14 дней колонии подсчитывали и оценивали как BFU-E, CFU-M, CFU-GM и CFU-GEMM в соответствии с руководством по «Анализу человеческих колониеобразующих единиц (КОЕ) с использованием MethoCult» от StemCell Technologies. Для экстракции ДНК из 96-луночных планшетов в лунки с колониями добавляли PBS, содержимое перемешивали и переносили в 96-луночный планшет с U-образным дном. Клетки осаждали центрифугированием при 300 × g в течение 5 минут с последующей промывкой PBS. Наконец, клетки ресуспендировали в 25 мкл раствора для экстракции ДНК QuickExtract (Эпицентр, Мэдисон, Висконсин, США) и переносили в планшеты для ПЦР, которые инкубировали при 65 ° C в течение 10 минут, а затем при 100 ° C в течение 2 минут.Для CCR5 была установлена ​​3-праймерная ПЦР с прямым праймером за пределами левого плеча гомологии (5′-CACCATGCTTGACCCAGTTT-3 ‘), прямым праймером, связывающим сигнал полиаденилирования во всех вставках (5’-CGCATTGTCTGAGTAGGTGT- 3 ‘), и обратное связывание праймера внутри правой руки гомологии (5′-AGGTGTTCAGGAGAAGGACA-3’). Премикс Accupower использовали для реакции ПЦР и проводили циклы при параметрах: 95 ° — 5 мин и 35 циклов 95 ° — 20 с, 72 ° C — 60 с. Фрагменты ДНК детектировали электрофорезом в агарозном геле.

Дифференцировка макрофагов и проточная цитометрия

CD34 + HSPC высевали с плотностью 2 × 105 клеток / мл в необработанные 6-луночные полистирольные планшеты в среде для дифференцировки (SFEM II с добавлением SCF (200 нг / мл), Il-3 ( 10 нг / мл), IL-6 (10 нг / мл), FLT3-L (50 нг / мл), M-CSF (10 нг / мл), GM-CSF (10 нг / мл), пенициллин / стрептомицин ( 10 Ед / мл) и культивировали при 37 ° C 5% CO 2 и 5% O 2 . Через 48 ч неприлипшие клетки удаляли из планшетов и повторно высевали в новый необработанный 6-луночный полистирол. планшеты при 2 × 105 клеток / мл в среде для дифференцировки.Прилипшие клетки поддерживали в тех же планшетах в поддерживающей среде (RPMI с добавлением FBS (10% об. / Об.), M-CSF (10 нг / мл), GM-CSF (10 нг / мл) и пенициллин / стрептомицин (10%). Ед / мл). Через три недели прилипшие клетки, содержащие терминально дифференцированные макрофаги, собирали путем инкубации с 10 мМ ЭДТА и осторожного соскабливания. Для фенотипического анализа мы собирали 1 × 10 5 клеток в каждом состоянии, ресуспендированных в 100 мкл окрашивающего буфера ( PBS, содержащий 2% FBS и 0,4% EDTA). Неспецифическое связывание антител блокировали (5% об. / Об. TruStain FcX, BioLegend, # 422302), и клетки окрашивали 2 мкл каждого моноклонального антитела, конъюгированного с флуорофором (30 минут, 4 ° C, темнота).Используемые антитела представляли собой hCD34-APC (BioLegend # 343510), hCD14-BV510 (BioLegend # 301842) и hCD11b-PE (BioLegend # 101208). Иодид пропидия (1 мкг / мл)) использовали для обнаружения мертвых клеток, и клетки анализировали на проточном цитометре BD FACSAria.

Анализ фагоцитоза

pHrodo Red Конъюгат E. coli BioParticles для фагоцитоза был приобретен у ThermoFisher, США и восстановлен до 1 мг / мл в среде, содержащей 10% FBS. Восстановленные биочастицы добавляли к макрофагам, полученным из IDUA-HSPC, и инкубировали при 37 ° C в течение одного часа.Затем клетки промывали и погружали в среду для визуализации (DMEM Fluorobright, 15 мМ HEPES, 5% FBS). Визуализацию следовали с использованием соответствующих максимумов поглощения и флуоресценции (560 нм и 585 нм, соответственно).

Мыши

NOD.Cg-Prkdc scid IL2rg tmlWjl / Sz (NSG) Мыши были созданы в лаборатории Джексона 67 .

Мышей содержали в 12-часовом цикле темнота / свет, в среде с контролируемой температурой и влажностью, с индивидуально вентилируемыми клетками под давлением, стерильными подстилками и неограниченным доступом к стерильной пище и воде в барьерном помещении для животных в Стэнфордском университете.Все эксперименты проводились в соответствии с руководящими принципами национальных институтов здравоохранения и были одобрены Университетской административной комиссией по уходу за лабораторными животными (IACUC 25065).

Трансплантация HSPC CD34

+ мышам NSG

Клетки-мишени (отсортированные или в массе) трансплантировали через четыре-пять дней после электропорации / трансдукции. YFP-отрицательные (YFP-) и YFP-положительные (YFP +) клетки были выделены с использованием FACS и ~ 400000 клеток были трансплантированы внутрибедренно в сублетально облученные (2.1 Гр) мышей в возрасте от 6 до 8 недель. Приблизительно 1 × 10 6 клеток HPSC были модифицированы кассетами без YFP и были трансплантированы в массе. Мышей случайным образом распределили в каждую экспериментальную группу и проанализировали слепым методом.

Оценка приживления трансплантата у человека

Через 16-18 недель после трансплантации у мышей-реципиентов были взяты образцы периферической крови, костного мозга и селезенки. Образцы обрабатывали хлоридом аммония для удаления зрелых эритроцитов. Неспецифическое связывание антител блокировали (10% об. / Об., TruStain FcX, BioLegend), клетки окрашивали (30 мин, 4 ° C, темнота) и анализировали, устанавливая ворота разброса ядерных клеток с использованием проточного цитометра BD FACSAria II или Анализатор BD FACSCanto II (BD Biosciences).Клетки анализировали на основе моноклональных антител к человеческому HLA-ABC APC-Cy7 (W6 / 32, BioLegend), антител к мышиному CD45.1 PE-Cy7 (A20, eBioScience, Сан-Диего, Калифорния, США), CD19 APC (HIB19, BD511 Biosciences), CD33 PE (WM53, BD Biosciences), антитела против mTer119 PE-Cy5 (TER-119, BD Biosciences) и CD3 PerCP / Cy5.5 (HiT3A, BioLegend) и йодид пропидия для обнаружения мертвых клеток . Человеческое приживление было определено как клетки HLA-ABC + / HCD45 + . Полный список антител см. В разделе «Дополнительные методы».

Анализ активности IDUA

Активность фермента IDUA измеряли флуорометрически с использованием 4-метилумбеллиферил-α-L-идуронида (4MU-идуронида) (LC Scientific Inc., Канада) в установленных условиях анализа 68 . Вкратце, для IDUA субстрат 4-метилумбеллиферил-идуронид разбавляют 0,4 М натрийформиатным буфером, pH 3,5, до концентрации 6,6 мМ. Двадцать пять микролитров аликвот субстрата смешивают с 25 мкл гомогенатов клеток или тканей и доводят до конечной концентрации субстрата 2.5 мМ. Смесь инкубируют при 37 ° C в течение 60 мин и добавляют 200 мкл глицинкарбонатного буфера (pH 10,4) для гашения реакции. 4-MU (Sigma) используется для построения стандартной кривой. Результирующую флуоресценцию измеряют с помощью планшет-ридера SpectraMax M3 с возбуждением при 355 нм и испусканием при 460 нм (молекулярные устройства).

Анализ ГАГ с использованием метода DMB

ГАГ в моче и тканях измеряли с помощью модифицированного анализа диметилметиленового синего (DMB) 69 . Образцы тканей (10–30 мг) инкубировали в течение 3 ч при 65 ° C в растворе переваренного папаина (PBS, не содержащий кальция и магния, содержащий 1% суспензию папаина (Sigma), 5 мМ цистеина и 10 мМ EDTA, pH 7.4) до конечной концентрации буфера 0,05 мг ткани / мл. Пятьдесят микролитров экстракта инкубировали с 200 мкл реагента DBM (9: 1 31 мкМ исходный DMB (в формиатном буфере 55 нМ): 2 М трис-основание). Образцы считывали на считывающем устройстве для микропланшетов при 520 нм.

Анализ ГАГ с помощью ЖХ / МС-МС

Дисахариды были получены из полимерных ГАГ путем расщепления хондроитиназой B, гепаритиназой и кератаназой II, что привело к DS (di-0S), HS (diHS-NS, diHS-0S) и KS (моносульфатированный KS, дисульфатированный KS).Хондрозин использовался в качестве внутреннего стандарта (IS). Ненасыщенные дисахариды, [ΔDiHS-NS, ΔDiHS-0S, ΔDi-4S, моносульфатированный KS и дисульфатированный KS были получены от Seikagaku Corporation (Токио, Япония) и использовались для построения стандартных кривых. Исходные растворы ΔDiHS-NS (100 мкг / мл), ΔDiHS-0S (100 мкг / мл), ΔDi-4S (250 мкг / мл), моно- и дисульфатированный KS (1000 мкг / мл) и IS (5 мг / мл) готовили отдельно в воде milliQ. Стандартные рабочие растворы ΔDiHS-NS, ΔDiHS-0S, ΔDi-4S (7,8125, 15,625, 31,25, 62,5, 125, 250, 500 и 1000 нг / мл), моно- и дисульфатированного KS (80, 160, 310, 630, 1250, 2500, 5000 и 10000 нг / мл), каждый из которых был смешан с раствором IS (5 мкг / мл).Аппарат масс-спектрометра, условия эксперимента, приготовление гомогената головного мозга и анализ дисахаридов выполняли, как описано в дополнительных методах.

Гистология

После кровотечения мозг транскардиально перфузировали физиологическим раствором с фосфатным буфером (PBS, pH 7,4), а затем 4% параформальдегидом (PFA) в PBS. Мозги фиксировали в течение ночи при 4 ° C. Затем мозг переносили на ночь в 30% раствор сахарозы для криозащиты, заключали в соединение Tissue-Tek OCT и разрезали (срезы 15–20 мкм) на замораживающем криостате (Leica, CM3050).Все ткани хранили при -80 ° C до дальнейшего использования. Для иммуногистохимии предметные стекла промывали PBS для удаления избытка OCT. Срезы блокировали в 10% нормальной козьей плазме (NGS; Gibco), содержащей 0,25–3% Triton X-100, в течение 1 ч при 25 ° C. Первичное антитело (анти-GFAP, 1: 500) наносили в течение ночи в 10% NGS с 0,1% Triton X-100 при 4 ° C, а затем применяли соответствующее вторичное антитело, конъюгированное с флуорохромом (конъюгаты Alexa; молекулярные зонды), в течение 1 часа при 25 ° C. С. Для визуализации микроглии изолектин GS-IB 4 из Griffonia simplicifolia , конъюгат Alexa Fluor 568 (Invitrogen-Molecular Probes, США) восстанавливали в виде исходного раствора 1 мг / мл в PBS с 0.5 мМ CaCl 2 и 0,01% азида натрия и предметные стекла инкубировали с рабочим раствором 5 мкг / мл в кальцийсодержащем PBS в течение одного часа при 25 ° C. Затем предметные стекла промывали PBS с 0,1% BSA, окрашивали Hoechst и помещали в Aqua Poly / Mount (Polysciences, Inc.) для флуоресцентной микроскопии. Слайды визуализировали с помощью обычной эпифлуоресцентной микроскопии с использованием универсального флуоресцентного микроскопа BZ-X800 (Keyence, Итаска, США).

Иммуноцитохимия

Клетки фибробластов MPSI (Coriell Cell Repository, GM000798) фиксировали в 4% параформальдегиде в фосфатно-солевом буфере (PBS), блокировали 3% бычьим сывороточным альбумином (BSA) в PBS и окрашивали кроличьим анти-LAMP1. (Abcam, ab24170, 1: 200) с последующими разведениями 1: 500 антикроличьих антител, конъюгированных с Alexa 488 (Molecular Probes).Монтаж и окрашивание ядер выполняли Vectashield с помощью DAPI (Vector labs). Слайды визуализировали с помощью обычной эпифлуоресцентной микроскопии с использованием охлаждаемой CCD-камеры (Hamamatsu), соединенной с инвертированным микроскопом Nikon Eclipse Ti. Изображения были получены с использованием программного обеспечения NIS elements и проанализированы с помощью ImageJ.

Компьютерная томография

Микро-КТ-снимки с высоким разрешением были получены в Стэнфордском центре инноваций в области визуализации in vivo (SCI 3 ) с использованием сканера eXplore CT 120 (визуализация TriFoil).Мышей анестезировали изофлураном (Baxter Corporation, Mississauga, ON, Canada). Сканы были получены с разрешением вокселей 100 мкм, уровнем энергии 80 кэВ и 360 градусами целых мышей. Программное обеспечение Microview (инновации Parallax) использовалось для визуализации и измерений изоповерхностей. Толщина черепа определялась количественно на среднесагиттальных изображениях. Длину бедренной кости определяли путем измерения длинной оси между двумя эпифизами. Толщину скуловой кости измеряли на коронковых срезах перпендикулярно оси скуловой кости.Длину костей определяли с помощью инструмента для измерения линий в MicroView. Бедра измерялись от основания латерального мыщелка бедра до кончика большого вертела.

Спонтанная двигательная активность

Все поведенческие экспериментаторы не знали генотип мышей на протяжении всего тестирования. Все испытания проводились в световом цикле. Во всех экспериментах животных приучали к тестовой комнате за 2 часа до тестов, и экспериментатор держал их в течение 3 дней перед всеми поведенческими тестами.Оценка спонтанной двигательной активности проводилась с использованием теста открытого поля на квадратной арене (76 × 76 см, 2 ) с непрозрачными белыми стенами, окруженными жалюзи, чтобы исключить внешние сигналы помещения. Мышей помещали в центр арены открытого поля и позволяли им свободно перемещаться в течение 10 минут, пока они отслеживались автоматической системой отслеживания Ethovision (Noldus Information Technology, Вагенинген, Нидерланды). Перед каждым испытанием поверхность арены очищалась дезинфицирующим средством Virkon.Для анализа арена была разделена на центральную (53,5 × 53,5 см, 2 ) и периферийную зону (шириной 11,25 см).

Пассивное тормозящее избегание

Тест пассивного тормозящего избегания использовался для оценки обучения и памяти на основе страха. Мы использовали систему с двумя отсеками (система GEMINI, San Diego Instruments), где освещенные и темные отсеки, оборудованные решетчатым полом, способным вызывать поражение электрическим током, разделены автоматическими воротами. В первый день каждую мышь приучали к устройству, помещая его в освещенное отделение.Через 30 с ворота открылись, открыв доступ в темный отсек. Когда мыши входят в темный отсек, ворота закрываются, и записывается время перехода после открытия ворот (время задержки). На 2-й день или день тренировки мыши получают ток 0,5 мА в течение 2 с после задержки в 3 с после перехода из освещенного отсека в темное. На 3-й день, или в день тестирования, после помещения в освещенное отделение на 5 с ворота открывались, открывая доступ в темное отделение. Задержка входа в темный отсек регистрировалась.Максимальное время перехода составило 10 минут.

Закапывание мрамора

Повторяющееся поведение было проверено в ходе испытания на закапывание мрамора. Отдельных мышей помещали в клетки, содержащие 20 черных стеклянных шариков (диаметром 1,5 см, четыре равноудаленных ряда по пять шариков в каждом) на поверхности подстилки глубиной 5 см. Через 30 минут в условиях низкой освещенности мышей удаляли и определяли количество шариков, которые были покрыты по крайней мере наполовину.

NSG-IDUA

X / X мышей

Мы использовали CRISPR-Cas9 для включения мутации W401X (UniProtKB — Q8BMG0), аналогичной мутации W402X, обычно обнаруживаемой у пациентов с тяжелым MPSI, в эмбрионы мышей NSG.Последовательность направляющей РНК-мишени была исследована с использованием crispr.mit.edu, и шесть включенных в короткий список направляющих рядом с целевым сайтом были сначала проверены с помощью анализа in vivo на клетках NIH 3T3. Были выбраны два направляющих, по одному с обеих сторон от целевого сайта: Guide1 (5′-TTATAGATGGAGAACAACTC-3 ‘) расщепляет 4 основания выше, а Guide3 (5′-GTTGGACAGCAATCATACAG-3′) отщепляет 44 основания ниже целевого сайта. Руководства были приготовлены путем транскрипции in vitro (HiScribe ™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) матрицы дцДНК, полученной отжигом двух олигонуклеотидов (с промотором Т7 в смысловом олиго) с последующей стандартной реакцией ПЦР.Донорская ДНК ssODN содержал точечную мутацию, предназначенный ведущий к стоп-кодон (TAG TGG с): 5’-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA / CTCT GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA / CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3 ‘(нижний регистр интрон, верхний корпус экзон, руководство срезанные участки отмечены «/» и мутация выделена жирным шрифтом).

Зиготы мышей получали путем скрещивания самцов-производителей NSG с супер-овулированными самками NSG.Самок мышей NSG в возрасте 3–4 недель (JAX Laboratories, номер запаса 005557) супер овулировали внутрибрюшинной инъекцией 2,5 МЕ гонадотропина сыворотки беременных кобыл (Национальная гормональная и пептидная программа, NIDDK) с последующей инъекцией 2,5 МЕ через 48 часов. хорионический гонадотропин человека (ХГЧ, Национальная гормональная и пептидная программа, NIDDK). Животных умерщвляли через 14 часов после введения ХГЧ и собирали оплодотворенные яйца. Смесь для инъекций CRISPR получали разбавлением компонентов в буфере для инъекций (5 мМ Tris, 0.1 мМ ЭДТА, pH 7,5) для получения следующих концентраций: 10 нг / мкл мРНК Cas9 (Thermo Fisher Scientific, Карлсбад, Калифорния), 10 нг / мкл IDUA1F и IDUA3F направляющей РНК и 10 нг / мкл донора ssODN (Integrated DNA Technologies, Коравиль, ИА). Инъекции зигот и перенос эмбрионов выполнялись по стандартным протоколам 70 . Всего было введено 38 зигот, оставшиеся 27 зигот были перенесены, что дало семь живых потомков. Среди них самец, гомозиготный по мутации, был использован для создания колонии NSG-IDUA X / X .Генотипирование мышей проводили с помощью амплификации на основе ПЦР с последующим секвенированием по Сэнгеру с использованием следующих праймеров: GENO F: 5′-CATGGCCCTGTTGGGTGAGTAATGA-3 ‘и GENO R: 5′-TGTGGTACTCCAGGCCGCTG-3’.

Измерение стабилизации белка р53 с помощью FAC

Человеческие HPSC инкубировали в доксорубицине (Sigma) при 0,2 мкг / мл в течение 6 часов. После сбора и промывки PBS клетки инкубировали с фиксируемым синим красителем мертвых клеток LIVE / DEAD в течение 15 мин (ThermoFisher, США). Клетки фиксировали 2% параформальдегидом в течение 10 мин при комнатной температуре и повышали проницаемость с помощью 0.1% Triton X-100 в PBS в течение 10 мин при комнатной температуре. Клетки блокировали с использованием 2% козьей сыворотки и 0,5% BSA в буфере для пермеабилизации (15 мин при комнатной температуре) и окрашивали меченным PE антителом против p53 (клон DO-7, Biolegend, США) или его изотипическим контролем в течение 1 ч при комнатной температуре. во тьме. Данные проточной цитометрии были получены с помощью FACSAria с использованием программного обеспечения FACSDiva (BD Biosciences).

TP53 Секвенирование гена

Секвенирование образцов было выполнено в Стэнфордской клинической лаборатории молекулярной генетической патологии с использованием клинически подтвержденного целевого анализа секвенирования следующего поколения (NGS).Акустический сдвиг выделенной геномной ДНК (сфокусированный ультразвуковой датчик M220, Covaris, Woburn, MA) сопровождается подготовкой библиотек для секвенирования (KK8232 KAPA LTP Library Preparation Kit Illumina Platforms, KAPABiosystems, Wilmington, MA) и обогащением мишени на основе гибридизации с индивидуальным сконструированные олигонуклеотиды (Roche NimbleGen, Madison, WI). Панель охватывает, частично или полностью, 164 гена, которые имеют клиническое значение при гематолимфоидных злокачественных новообразованиях, включая TP53 . Объединенные библиотеки секвенируют на инструментах секвенирования Illumina (MiSeq или NextSeq 500 Systems, Illumina, Сан-Диего, Калифорния).Результаты секвенирования анализируются с помощью биоинформатического конвейера собственной разработки. Выравнивание последовательности относительно эталонного генома человека hg19 выполняется с помощью BWA в режиме парных концов с использованием алгоритма BWA-MEM и стандартных параметров. Вызов вариантов выполняется отдельно для однонуклеотидных вариантов (SNV), вставок и делеций <20 п.н. (Indels) и слияния. VarScan v2.3.6 используется для вызова SNV и Indels, а FRACTERA v1.4.4 используется для вызова слияний. Варианты аннотируются с использованием справочных транскриптов Annovar и Ensembl.Анализ может обнаруживать варианты с фракцией вариантного аллеля ниже 5%.

КПЦР для генов-мишеней р53

Сбор

РНК проводили с использованием набора RNeasy Mini (Qiagen, 74104) в соответствии с инструкциями производителя. РНК (2–7 мкг) обрабатывали ДНКазой I (Invitrogen DNA-free, AM1906) в соответствии с инструкциями производителя. Обратную транскрипцию выполняли с помощью обратной транскриптазы M-MLV (Invitrogen, 28025) и случайных праймеров (Invitrogen, 48190). Для синтеза кДНК использовали 1 мкг общей РНК.Все образцы в эксперименте подвергали обратной транскрипции в одно и то же время, полученную кДНК разводили 1: 5 в воде, свободной от нуклеаз, и хранили в аликвотах при –80 ° C до использования. Количественную ПЦР проводили в трех экземплярах с использованием мастер-микса PowerUP SYBR green (Life Technologies, A25743) и машины 7900HT Fast Real-Time PCR (Applied Biosystems). Анализ экспрессии выполняли с использованием конкретных праймеров для каждого гена (Таблица X). Среднее значение гена домашнего хозяйства HPRT использовали в качестве внутреннего контроля для нормализации вариабельности уровней экспрессии.Все qRT-PCR, выполненные с использованием SYBR Green, проводились при 50 ° C в течение 2 минут, 95 ° C в течение 10 минут, а затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 1 минуты. Специфичность реакции подтверждали анализом кривой плавления. Для количественного определения образцов использовали стандартную кривую. Список праймеров qRT-PCR см. В разделе «Дополнительные методы».

Статистический анализ

Все статистические тесты, включая парные и непарные t-тесты и односторонний дисперсионный анализ (ANOVA) с последующим тестом множественных сравнений Тьюки, были выполнены с использованием GraphPad Prism версии 7 для Mac OS X, GraphPad Software, La Jolla Калифорния, США.Данные были представлены как средние значения, когда все условия прошли три теста на нормальность (D’Agostino & Pearson, Shapiro-Wilk и тест нормальности KS).

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета об исследовании природы, связанном с этой статьей.

Поиск по коллекциям ботаники

Коллекции растений Смитсоновского института начались с приобретения образцов, собранных Исследовательской экспедицией Соединенных Штатов (1838-1842).Они легли в основу Национального гербария, который сегодня насчитывает более 5 миллионов исторических записей о растениях, что делает его одним из крупнейших и наиболее важных в мире.

В настоящее время в этом онлайн-каталоге доступно более 4,2 миллиона записей об образцах (в том числе более 115 000 типовых образцов с изображениями).

Выберите вкладку на этой странице для поиска по ключевому слову или выбранным полям. Поиск ограничен 10000 записями, а результаты сортируются по таксономической группе. Если вам нужно получить больший набор записей, обратитесь к менеджеру данных Департамента ботаники.

Заявление об отказе от ответственности: Записи коллекций гербария США могут содержать образцы этикеток, которые содержат оскорбительные или культурно нечувствительные выражения. Эти записи отражают не текущую точку зрения Гербария США, а скорее социальные установки и обстоятельства того периода времени, когда образцы были собраны или каталогизированы.

См. Вкладку «Справка», чтобы узнать больше о поиске и последующем изучении возвращенных результатов (сортировка, экспорт и т. Д.).

Поиск в реестре ботанических типов Search Plant Фото изображения Поиск ботанического искусства

Используйте поиск по полю , чтобы найти данные образца, которые соответствуют значениям в определенных полях базы данных.Введите значение или выберите одно из раскрывающихся списков.

  • Нажмите кнопку Search , чтобы начать поиск. Очистить сбрасывает все поля.
  • Некоторые списки связаны, поэтому, например, выбор Страна сужает выбор для
    провинция / штат / территория и район / округ . Выпадающие варианты также
    сужение при вводе, например, ввод zing в поле Family может сузить выбор до Zingiberaceae .
  • Установите флажок Только записи с изображениями , если вы хотите ограничить поиск записями с мультимедийным содержимым.
  • Вы можете принудительно выполнить точный поиск, заключив поисковый текст в двойные кавычки. Точное означает точное,
    поиск чувствителен к регистру и должен соответствовать значению всего поля. Точный поиск также
    для завершения потребуется гораздо больше времени.
  • Вы получите предупреждение, если введете неверную информацию в текстовые поля.Например,
    Каталожные номера состоят строго из букв и цифр; другие персонажи вызывают предупреждение.

Введите ключевые слова, разделенные пробелами, и нажмите Поиск . Записи, соответствующие вашему поиску
условия будут возвращены.

  • Вы можете присоединиться к условиям с помощью ИЛИ, чтобы соответствовать любому, например Гуам ИЛИ Палау
  • Вы можете использовать термины изображение (я) или тип (и) , чтобы найти записи, которые содержат изображения или являются типовыми образцами.
  • Для поиска каталожных номеров замените пробелы дефисами, например вместо ABC 12345 ,
    используйте ABC-12345 . Не включайте никаких других терминов.

Обратите внимание, что поиск общих (наречий) имен может не дать ожидаемых результатов. Связывание общих имен с записями об образцах находится в стадии разработки.

Пример поиска по ключевому слову: marantaceae australia images

Результаты вашего поиска могут отображаться в Grid (сортируемая, настраиваемая таблица)

или Просмотр галереи (лучше всего для просмотра изображений).Используйте кнопку переключения
для переключения между этими представлениями.

  • Вы можете выбрать, отображать ли одновременно 5, 10, 20, 50 или 100 записей.

В режиме просмотра листа :

  • Щелкните научное название, чтобы просмотреть полную запись.
  • Щелкните миниатюру, чтобы просмотреть изображение с большим разрешением. Используйте Control + щелчок
    (Command + щелчок), чтобы открыть новую вкладку браузера.

В представлении сетки :

  • Вы можете выбрать столбцы для отображения в раскрывающемся меню любого столбца (наведите указатель мыши на
    заголовок столбца и щелкните значок раскрывающегося списка).В разделе Столбцы щелкните имя
    для отображения или скрытия поля (вам не нужно специально устанавливать флажок).
  • Вы можете перетащить заголовок столбца, чтобы изменить его порядок отображения в сетке.
  • Вы также можете перетащить край столбца, чтобы сделать его шире или уже.
  • Щелкните в расширении
    ()
    столбец, чтобы просмотреть полную запись.

В Галерея Просмотр :

  • Щелкните изображение, чтобы просмотреть полную запись.

См. Экспорт результатов для получения информации о загрузке результатов, например, в
Excel или Google Планета Земля.

Откройте полную запись коллекции, нажав кнопку расширения
()
в Grid View ,
по научному названию в режиме просмотра листа,
или в любом месте кадра изображения в Gallery View . Кнопки обратного расширения
()
указывают записи с мультимедиа (как правило, изображения).

  • В окне «Запись» метаданные для мультимедийного содержимого становятся доступными при наведении указателя мыши на эскиз.
  • Щелчок по миниатюре открывает контент в вашем браузере или другом подходящем приложении.
  • Размер окон записи можно изменять или перемещать внутри окна браузера.
  • У вас может быть открыто до десяти окон записи одновременно.

Сортируйте результаты в Grid View , щелкнув заголовок столбца (или выбрав Сортировать из
раскрывающееся меню столбца).

  • Сортировка по нескольким столбцам путем последовательной сортировки столбцов в обратном порядке.
    Например, чтобы просмотреть результаты, отсортированные по стране и провинции / штату, сначала выполните сортировку по
    Провинция / штат, а затем снова выполните сортировку по странам.
  • Для любого столбца вы можете выбрать сортировку по возрастанию или убыванию.

Экспортируйте все или выбранные результаты, нажав кнопку Экспорт результатов как CSV в
нижняя панель инструментов в Сетка
, Лист,
или Просмотр галереи .

  • Выберите отдельные записи для экспорта, установив флажок выбора экспорта.
    (по левому краю сетки Grid View ).
  • Снимите все выделения с помощью кнопки Clear Selections на нижней панели инструментов.
  • Результаты экспортируются как значения, разделенные запятыми, по одной записи в строке, которые можно сохранить.
    на диск или открываются напрямую с помощью таких приложений, как Microsoft Excel.

Вы также можете экспортировать все или выбранные результаты в файл KML для просмотра с помощью Google Планета Земля или других программ просмотра KML, нажав кнопку Export as KML. Эта кнопка отображается серым цветом, если для всех или выбранных результатов отсутствуют значения широты / долготы.

Вот несколько советов по поиску:

  • Результаты запроса ограничены 10000 записями. Избегайте очень общих вопросов, которые
    вернуть очень большое количество записей, например ищет poaceae .
  • Вы можете выбрать, какие столбцы будут отображаться в таблице результатов поиска.
    Наведите указатель мыши на заголовок любого столбца и щелкните стрелку раскрывающегося списка.Прокрутка
    до Столбцы , а затем установите или снимите флажки с имен столбцов, чтобы отобразить или скрыть те
    столбцы в сетке.

Чтобы создать ссылку на определенные записи в NMNH , предоставьте строку запроса для:

https://collections.nmnh.si.edu/search/botany/?QUERYSTRING

где QUERYSTRING (используйте знак плюса для разделения нечувствительных к регистру терминов):

  • Один или несколько НОМЕРОВ КАТАЛОГА, e.г.

    • ботаника /? Nb = d-29033
    • ботаника /? Nb = 2104733 + 2578387-a + 2641
  • Один или несколько ШТРИХОВ, например

    • ботаника /? Bc = 00007842 + 00588979
    • ботаника /? Bc = 01132034
  • НАИМЕНОВАНИЕ образца, например:

    • ботаника /? Qn = abutilon
    • ботаника /? Qn = zea + perennis
  • НАИМЕНОВАНИЕ ТИПОВОГО образца, e.г.:

    • ботаника /? Qt = stenogyne + crenata + var + muricata
    • ботаника /? Qt = jatropha
  • ОБЩИЙ запрос, поиск по любой комбинации: ИМЯ (qn), СЕМЬЯ (fm), СТАТУС ТИПА (ts),
    КОЛЛЕКТОР (cr), КОЛЛЕКЦИЯ (cn), НАЗВАНИЕ ЭКСПЕДИЦИИ (ex), ГЕНЕТИЧЕСКИЙ ОБРАЗЕЦ (gs) или ТОЛЬКО С ИЗОБРАЖЕНИЯМИ (io),
    например.:
  • Чтобы открыть поиск по коллекциям на определенной вкладке поиска, e.г.

    • botany /? Ti = 3 (Введите поиск в регистр)

    Вкладки нумеруются слева направо, начиная с нуля.

Лучше всего использовать только буквы, цифры, плюсы (+), тире (-) и запятые в ваших запросах ,
и избегать других персонажей.

Используйте страницу обратной связи, чтобы сообщить о проблемах, которые вы обнаружите с данными или с использованием
эти страницы поиска.

% PDF-1.3
%
1 0 объект
> / Метаданные 534 0 R / Страницы 2 0 R / Тип / Каталог / PageLabels 10 0 R >>
эндобдж
534 0 объект
> поток
uuid: f83bd4d8-826a-4a13-b429-9ff6f90c0f9aadobe: docid: indd: 88c6dfca-390b-11df-982a-9b855292e6a0proof: pdf88c6dfc9-390b-11df-982a-9b55da8-9b55d02d2: 98cb8d2d2db8c8d2d09db8c8d02db8db8d09db6d2d2db8c8d0d09b8c8d0d2 АртикулStream300.00300.00Inchesuuid: E99116EAF13ADF11BF4CB3BA9C761285uuid: E89116EAF13ADF11BF4CB3BA9C761285

  • СсылкаStream300.00300.00 Inchesuuid: F16E5F63F63ADF11BF4CB3BA9C761285uuid: 26733985F53ADF11BF4CB3BA9C761285
  • АртикулStream300.00300.00Inchesuuid: E6EEEFA5843CDF11AD0CAE57171BF5D1uuid: 22733985F53ADF11BF4CB3BA9C761285
  • Артикул 300.00300.00 Inchesuuid: ECAEB1B8843CDF11AD0CAE57171BF5D1uuid: AAC78971F63ADF11BF4CB3BA9C761285
  • АртикулStream300.00300.00Inchesuuid: 0D529616F73ADF11BF4CB3BA9C761285uuid: 0C529616F73ADF11BF4CB3BA9C761285
  • СсылкаStream300.00300.00 Inchesuuid: 2E93C12BF73ADF11BF4CB3BA9C761285uuid: 2D93C12BF73ADF11BF4CB3BA9C761285
  • Артикул 72.0072.00 Inchesuuid: 609772F9F23ADF118AA7F0F2B41DC2DEuuid: 5F9772F9F23ADF118AA7F0F2B41DC2DE
  • 2010-07-09T18: 50: 23 + 05: 302010-07-09T18: 50: 25 + 05: 302010-07-09T18: 50: 25 + 05: 30Adobe InDesign CS3 (5.0) application / pdfAdobe PDF Library 8.0False
    конечный поток
    эндобдж
    2 0 obj
    >
    эндобдж
    10 0 obj
    >
    эндобдж
    8 0 объект
    >
    эндобдж
    235 0 объект
    >
    эндобдж
    234 0 объект
    >
    эндобдж
    443 0 объект
    >
    эндобдж
    233 0 объект
    > / Font> / ProcSet [/ PDF / Text] / ExtGState >>> / Type / Page >>
    эндобдж
    250 0 объект
    > / ColorSpace> / Font> / ProcSet [/ PDF / Text / ImageB] / ExtGState >>> / Type / Page >>
    эндобдж
    269 ​​0 объект
    > / Font> / ProcSet [/ PDF / Text] / ExtGState >>> / Type / Page >>
    эндобдж
    284 0 объект
    > / Font> / ProcSet [/ PDF / Text] / Свойства >>> / ExtGState >>> / Type / Page >>
    эндобдж
    427 0 объект
    > / Font> / ProcSet [/ PDF / Text] / ExtGState >>> / Type / Page >>
    эндобдж
    442 0 объект
    > / Font> / ProcSet [/ PDF / Text] / ExtGState >>> / Type / Page >>
    эндобдж
    492 0 объект
    > / Font> / ProcSet [/ PDF / Text] / ExtGState >>> / Type / Page >>
    эндобдж
    510 0 объект
    > поток
    HW [o: ~ УYQu1i./.GwYg#ВA

    gOOW7V_ ڞ [f1ʎ9_kЉ` =
    WH EDVз / yYYlRy0D \ j: + qW} bf ڷ [uoi \ ŋYĹʊ; 85YZwSq̠ ~ ieYj @
    / vͲzK) @ 7x / qYųxnv D \ FJ * «ퟋǴ @ # + PU
    ~ ٢hb8 {Lpqhfni̾} .2F
    Ač *) yV6C` 5LtuY «Z $ 0,0q +] 9 (V؟ mJXdTc57qR

    .FZ1 * 2ɫ4Yg8A, omL

    Frailty предсказывает невозможность выписки пациентов домой из отделения подострого лечения: 3-летний опыт работы в Италии

    В этом исследовании мы описали клинические характеристики и исходы когорты пациентов, поступивших в нашу SCU в течение 3-летнего периода.Мы обнаружили, что пациенты были старыми или очень старыми и имели тяжелое бремя инвалидности и гериатрических синдромов, включая слабость и делирий. Около 46% из них не вернулись домой после пребывания в SCU, их перевели в другие учреждения, кроме дома, и, таким образом, они столкнулись с фрагментацией медицинской помощи. Оценка BI, уровень хрупкости и использование мочевого катетера при выписке были единственными факторами, независимо связанными с риском невыписки домой.

    Наши результаты аналогичны предыдущим исследованиям с участием пациентов, помещенных в отделения промежуточной медицинской помощи по разнородным причинам, т.е.е., не только для конкретных условий, таких как те, которые предназначены для реабилитационных учреждений [11,12,13,14,15,16]. Например, мы обнаружили, что пациенты с нарушением когнитивных функций, оцененные с помощью MMSE (то есть с оценкой менее 24/30), составляли 37,7% от всей исследуемой популяции, что очень похоже на то, о котором сообщает Gual et al. al. [13] и Ноаман и др. [14]. Делирий возник у 14,5% субъектов, что аналогично проценту, описанному Bellelli et al. [11]. По данным Национального аудита промежуточной медицинской помощи (NAIC) Англии за 2017 год [17], оценка BI при приеме составила 54.Сообщалось о 1 для стационарных услуг (которые включают отделения интенсивной терапии и дома престарелых), что соответствует нашим выводам. Некоторые различия, вероятно, из-за различных критериев приема в разных странах, также наблюдались между нашим исследованием и предыдущими исследованиями, в которых также сообщалось о отделениях промежуточной помощи. Например, Sanchez-Rodriguez et al. сообщили о более низких значениях BI в своей популяции [15]. Кроме того, хотя мы обнаружили, что недоедающие составляли 26,7% исследуемой популяции, и только 19,8% имели нормальный статус питания, исследование Thomas et al.проведенное в центре подострой помощи в Сент-Луисе, сообщило о еще более высоком проценте субъектов (около 90%), которые страдали от недоедания или имели риск недоедания [16]. В целом пациенты, госпитализированные в отделения интенсивной терапии, демонстрируют высокий уровень сложности, о чем свидетельствуют не только сопутствующие заболевания, но также когнитивный, функциональный статус, статус питания и слабость.

    Важным выводом нашего исследования является то, что слабый фенотип у пациентов, поступивших в отделение интенсивной терапии, был независимо связан с риском того, что их не выпишут домой.Мы обнаружили, что принадлежность к группе «слабости от средней до тяжелой» и к группе «очень тяжелой или неизлечимо больной» увеличивает вероятность выписки в другое место, кроме дома, более чем в пять и шесть раз соответственно. При моделировании СХУ по непрерывной шкале скорректированный риск того, что вас не выпишут домой, увеличивался с увеличением категории слабости, то есть с каждым увеличением на один балл СХУ риск исхода увеличивался на 60%.

    Мы не нашли никаких предыдущих исследований, проведенных в аналогичных условиях, в которых использовалась бы CFS для оценки дряхлости.В исследовании Gual и его коллег [23] пациенты были разделены на две группы: пациенты с хроническим комплексом (ХПК) и «неустановленные». Критерии группировки включали множество характеристик, в том числе слабость, но методы оценки не указывались. Учитывая количество субъектов в этих группах (CCP = 91 и «неопознанные» = 153), мы могли бы предположить, что распространенность дряхлости намного ниже, чем в нашей SCU, где слабые субъекты составляют более двух третей всех пациентов. исследование населения.

    Насколько нам известно, только одна статья исследовала взаимосвязь между слабостью и местом назначения выписки в условиях, подобных нашему [18]. Применяя Эдмонтонскую шкалу хрупкости (EFS) пациентам в возрасте 75 лет и старше, Хейли и его коллеги пришли к выводу, что рутинная оценка слабости не является полезным предиктором места назначения после выписки, дихотомически разделенной на «сообщество (хороший результат)» и « интернатное лечение (плохой исход) ». Напротив, более высокий уровень дряхлости предсказывал лучший уровень участия в сеансах физиотерапии [18].Однако из-за отсутствия данных авторам удалось достичь только окончательного размера выборки в 75 субъектов, что не соответствовало необходимому количеству ( n = 85) для выявления значительной взаимосвязи между слабостью и исходами выписки (степень 0,80, альфа 0,05). Более того, авторы сообщили, что EFS, возможно, неадекватно отразил фенотип слабости в этой когорте, учитывая, что эта шкала кажется более подходящей для оценки слабости среди местных жителей.

    Наши результаты имеют важное значение: они показывают, что CFS можно использовать для прогнозирования места выписки пациентов, поступивших в SCU, и какие переменные указывают на то, что пациент, вероятно, будет выписан где-нибудь, кроме дома.Цель SCU — избежать длительного пребывания в больнице и способствовать выписке из больницы. Таким образом, SCU составляют ключевой элемент сети здравоохранения, в идеале обеспечивая так называемую «непрерывность оказания помощи» между больницей и населением [19]. Однако, чтобы получить от такой услуги эффективность, важно правильно отбирать пациентов. Обнаружение того, что около половины наших пациентов не вернулись домой, прямо указывает на необходимость пересмотра текущих критериев приемлемости, предусмотренных нашей региональной системой здравоохранения для приема в отделения SCU.Фактически, эти критерии в основном учитывают клиническую нестабильность и наличие острых заболеваний, но не учитывают слабость или другие показатели индивидуального биологического резерва. Острые заболевания и сопутствующие заболевания являются одномерными показателями состояния здоровья пациента, в то время как дряхлость является многомерной мерой и, следовательно, более подходящей для отражения сложности биологического статуса человека [20]. Мы предлагаем, чтобы оценка дряхлости стала ключевым элементом для получения права на получение SCU: наши результаты ясно показывают, что пациенты с более высоким уровнем дееспособности не получают пользы от госпитализации в SCU и что они повторно входят в систему здравоохранения с дальнейшими периодами госпитализации через разные настройки ухода.В свою очередь, эта «фрагментация помощи» несет в себе дополнительный риск физического и / или когнитивного ухудшения, что может привести к неблагоприятным результатам, таким как постоянное помещение в специализированные учреждения. Возможно, субъектов с повышенным уровнем слабости следует перенаправить в более подходящие учреждения (например, реабилитационные учреждения, дома престарелых или хоспис). В качестве альтернативы национальные службы здравоохранения должны инвестировать больше ресурсов в SCU, например, финансировать набор необходимого персонала SCU, такого как физиотерапевты, эрготерапевты и эксперты по уходу за пациентами в конце жизни.

    Стоит упомянуть открытие, что наличие катетера мочевого пузыря в конце госпитализации увеличивает вероятность того, что его не выпишут домой. Предыдущие отчеты уже показали, что катетеризация мочевого пузыря связана с плохими исходами для здоровья пациента, включая делирий [21], инфекции мочевыводящих путей, сепсис, повышенную смертность, более длительное пребывание в больнице и более высокие затраты на лечение [22, 23]. Согласно метаанализу Saint et al., Примерно у четверти пациентов с катетерами мочевого пузыря развивается бактериурия.Из них 24% перерастают в симптомы инфекции мочевыводящих путей и 3,6% — в бактериемию [22]. Учитывая, что такие состояния часто требуют высокого уровня ухода, такие пациенты с меньшей вероятностью будут выписаны домой. Поскольку катетеризация мочевого пузыря является изменяемым фактором риска, медицинские работники должны знать о последствиях ее длительного использования. Обучение тому, как избегать — или, по возможности, ограничивать — использования катетеризации, следует внедрять на всех уровнях непрерывной помощи.

    Результаты этого исследования следует интерпретировать с учетом его ограничений. Во-первых, дизайн с одним центром ограничивает обобщение наших результатов на другие центры по уходу. Во-вторых, наша ОМУ была открыта физически рядом с отделением неотложной терапии, и этот факт мог косвенно повлиять на отбор пациентов. Действительно, мы предполагаем, что некоторые пациенты с остаточной клинической нестабильностью могли быть госпитализированы в отделение интенсивной терапии из-за близости двух палат. Более того, переменные, описывающие роль опекуна и экономические ресурсы для каждого пациента, могли иметь значение для интерпретации нашего результата, а также причины отказа от выписки домой.Однако они не были собраны. Еще одно ограничение представлено размером выборки. Действительно, некоторые из переменных, протестированных в логистической регрессии, показали большие доверительные интервалы, и поэтому мы не можем исключить, что при увеличении исследуемой совокупности другие переменные могут достичь статистической значимости в многомерном анализе. Что касается использования CFS для оценки дряхлости, мы признаем, что этот инструмент не прошел валидацию для выявления дряхлости у лиц моложе 65 лет, и мы признаем это ограничением исследования.Однако следует подчеркнуть, что дряхлость также характерна для молодых людей, особенно если они проходят длительную госпитализацию, например, люди, поступившие в отделение интенсивной терапии. Поэтому вполне вероятно, что, используя CFS, мы не переоценили истинную долю слабых людей в нашей когорте. Наконец, в нашей больнице обычно практикуется, что только часть пациентов проходит реабилитацию. Действительно, учитывая нехватку физиотерапевтов, отбор пациентов, подходящих для реабилитации, основан на предварительной оценке двух физиотерапевтов, работающих в нашей больнице.Обычно они склонны отбирать только тех пациентов, которые, по их мнению, получат наибольшую пользу от физиотерапии, и весьма вероятно, что среди них была лишь небольшая часть пациентов, поступивших в нашу SCU. Мы понимаем, что это еще одно ограничение нашего исследования.

    Сильные стороны этого исследования многочисленны. Во-первых, участников набирали проспективно и последовательно, чтобы свести к минимуму систематическую ошибку отбора. Во-вторых, всем госпитализированным пациентам систематически проводилась комплексная гериатрическая оценка.В-третьих, CFS и комплексная гериатрическая оценка проводились опытными гериатрами, а медсестры и вспомогательный персонал были обучены использованию и применению утвержденных гериатрических шкал с целью унификации метода оценки и сбора данных.

    Страшный учитель 3-го уровня 5

    Страшный учитель 3-го уровня 5

    О числах Тедди. Teddy Numbers — интерактивная игра для детей младшего возраста. Они могут весело провести время, научившись считать до 15 предметов, с помощью простого упражнения на перетаскивание.

    Scary Teacher 3D — Gameplay Walkthrough Part 133 Глава 1 Все новые уровни (Android, iOS) Pranks Surprise Trap, Trouble In A Bowl, The TV Villian, Outfit Woes, Pin …

    поддержали учителей пятого класса в четырех начальных школах для выполнения круглогодичных 5 писательских проектов, вдохновленных классическими или популярными детскими книгами, что позволяет ученикам творчески реагировать на высококачественные детские художественные и научно-популярные тексты. Школы выбрали для своей школы «Книгу письма»: ту, которая, по их мнению, вдохновит детей на письмо.

    18 февраля, 2019 · От известного поведенческого нейробиолога и вылечившего наркотик …

    5 января 2015 · Мальчики и девочки, игроки и неигровые ученики получили одинаковую оценку на тесте обучения Все 0 часов в неделю От 1 до 5 часов в неделю 6+ часов в неделю Контроль над иммунными атаками 0 5 10 15 20 Все девочки Мальчики Самостоятельно сообщил о часах в неделю, в которых играли в видеоигры.

    30 января 2020 г. · Прохождение уровня 5-6 Miles and Kilo. … Страшный учитель 3D Глава 1 Прохождение. Прохождение.14 ноября 2020 г. Прохождение Уровня 6 Plants vs Zombies Heroes. Прохождение.

    Monkey GO Happy: В Monkey Go Happy ваша работа — подбодрить эту грустную обезьяну. Каждый уровень — это головоломка или игра, которую вы должны решить. Решите их все так быстро, как только сможете, чтобы набрать наивысший балл и заставить этого примата гордиться!

    Expatica — это онлайн-дом международного сообщества вдали от дома. Expatica, обязательное к прочтению англоговорящими иностранцами и иностранцами по всей Европе, предоставляет специализированную службу местных новостей и важную информацию о жизни, работе и переезде в выбранную вами страну.

    Ai shoujo жилищная карта

    Скачать Scary Teacher 3D apk 5.7.3 для Android. Пора напугать страшного школьного учителя! Симулятор учителя Автор: Сэм Ю Платформы: iOS, Android Симулятор учителя — мобильная игра, разработанная Сэмом Ю для устройств iPhone и Android! Посмотрите видео ниже и узнайте, как играть и пройти этот уровень. Страшный Симулятор Scaredy TEACHER — Геймплей — Прохождение — Уровень 5–8 [Android — IOS], в котором участвует Android Gameplay BRO.

    Постоянный настольный кронштейн монитора

    Scary Teacher 3D Game Play Online.Школьные годы — непростое время для многих учеников. Вы, наверное, со страхом вспоминаете тонны домашних заданий, скучные уроки и ужасные оценки. Но самое страшное, что ждет любого школьника или девочку, — это учителя. Не все из них хороши. Некоторые, кажется, пришли из ваших самых ужасных кошмаров.

    Google Фото — это дом для всех ваших фото и видео, которые автоматически упорядочиваются и легко публикуются.

    Нил пробивается сквозь врагов на 5 уровне, чтобы получить Волшебный свисток.По пути, чтобы получить свисток, трое Темных Орехов устраивают засаду на Нила, который пытается поразить их лучом своего меча. К сожалению, Темных Орешков они не беспокоят. Пока Нил отвлекается, появляется Темный Орешек и сбивает его без сознания. Попытайтесь довести свой до категории 5, вызвать сильные наводнения, повредить более 3000 построек и добиться выхода на сушу в более чем 5 странах. Эта игра не только развлекает и помогает скоротать время, но и является образовательной, поскольку вы изучаете технические аспекты урагана, чтобы быть более осведомленными и подготовленными к реальным.

    Ffxi nasomi

    SPIK3R. Это шестиногое существо не только похоже на скорпиона, но и действует как скорпион. Он резко поворачивается, щелкает своим сокрушительным когтем, и его молниеносный хвост готов выстрелить в кого угодно или что угодно, что встанет у него на пути.

    Уровень мастерства: 5 Материалы: боевой молот, бронза, бронза, железо. Уроки: оружие для начинающих 2 (вторник, уроки Барретта) Цена продажи: Большой молот 1920 г —— Описание: молоток, предназначенный для нанесения урона на пользователь при ударе.Красиво сбалансированный.

    После своих подвигов на острове во время летних каникул, класс 3-E продолжает точить лезвия, нацеливаясь на своего учителя, скользкого Коро-сенсея. Однако им есть о чем беспокоиться, а не только об их учителе, поскольку вражеские убийцы, как старые, так и новые, ждут увеличенной награды за голову осьминога. Мультимедиа ФБР с изображениями и видео. Эти изображения предназначены для использования вами в рекламе ФБР и могут использоваться без оплаты или разрешения.

    Тайваньский флот

    Бесплатный редактор изображений с открытым исходным кодом. Это официальный сайт программы обработки изображений GNU (GIMP). GIMP — это кроссплатформенный редактор изображений, доступный для GNU / Linux, OS X, Windows и других операционных систем. Это бесплатно

    Адам и Ева — два пещерных человека, которым предстоит отправиться в увлекательное приключение. Вы можете присоединиться к ним в первой части их пути в этой милой и сложной онлайн-игре. Можете ли вы помочь им решить головоломки по пути и разобраться со всем, что преграждает им путь?

    The Student Room, Get Revision and Marked by Teachers являются торговыми марками The Student Room Group Ltd.Регистрационный номер: 04666380 (Англия и Уэльс), номер плательщика НДС 806 8067 22 Зарегистрированный офис: International House, Queens Road, Brighton, BN1 3XE Или способствовать позитивным отношениям между учителем и учеником? Ниже представлена ​​библиотека с детальными планами уроков до пятого уровня от Education.com, созданная преподавателями. Благодаря нашим бесплатным планам уроков по математике, чтению и письму и естествознанию, обучение будет приятным и значимым для каждого ученика.

    Обзор и решение по сбору доказательств

    Играйте в Snake Game в браузере.Нажмите, чтобы начать игру. Ешьте еду, развивайтесь и не наезжайте на себя. Впервые выпущен в середине 1970-х годов для игровых автоматов и с тех пор сохраняет популярность.

    Поэзия — прекрасный способ для студентов проявить творческий подход, выразить свои мысли и попрактиковаться в описательном письме. С помощью наших заданий по поэзии для пятого класса ваши ученики познакомятся с чтением стихов и написанием своих собственных.

    Психоделический уровень Для обсуждения с другими психонавтами необходима шкала для определения «психоделического уровня» поездки.Де-факто стандартом, по крайней мере, в Интернете, является шкала Грэма Карла от 0 до 5, которая оказалась более детальной и работоспособной, чем система «трех плюсов» Шульгина. Academia.edu — это платформа, где ученые могут делиться исследовательскими работами.

    2006 обход системы безопасности dodge ram

    01 января 2020 г. · Тренировка в тренажерном зале уровня 1: Ваш первый день в тренажерном зале. Тренировка в тренажерном зале уровня 2: кардио-кадет. Тренировка в спортзале уровня 3: бригада веса тела. Тренировка в спортзале 4 уровня: Дивизион гантелей. Тренировка в спортзале 5 уровня: батальон со штангой.Тренировка в спортзале 6 уровня: Герой спортзала. Этикет в спортзале: советы и хитрости. Как выработать привычку заниматься в спортзале. Боитесь тренироваться в тренажерном зале? Прочтите это в первую очередь.

    Investigação qualitativa em education pdf. Годовой отчет Hard Rock Cafe за 2018 год. Низкие сборы в университетах великобритании. Создайте матричный отчет в salesforce lightning. Mgt613 assignment solution 2018. Сколько предложений в коротком эссе. Музыкальное образование Чикагского университета. Католический университет Sacro cuore. Действующая система образования в Нигерии такова.

    Вы умеете проходить сложное место в игре? Огромное количество прохождение игр на видео.Les 37e journées européennes du patrimoine auront lieu les 19 et 20 septembre 2020, autour du thème: «Патримоин и образование: apprendre pour la vie!

    Hummer h5 цена в Индии

    Les 37e journées européennes du patrimoine auront lieu les 19 et 20 septembre 2020, autour du thème: «Patrimoine et образование: apprendre pour la vie!

    Работа, обучение и навыки. Работа в Barnet, обучение и поддержка навыков

    Amazon часто проводит акции, в которых вы можете потратить минимальную сумму на выбранные продукты и получить взамен кредитную или подарочную карту Amazon, обычно в размере от 5 до 30 долларов США.Хотя у Amazon в настоящее время нет политики корректировки цен, они предлагают вознаграждение за возврат наличных, которое может быть добавлено к вашему будущему балансу Amazon Pay. Среда была действительно тяжелой. У меня было 5 классов подряд, и у меня был мой самый низкий класс 5-го класса, 5/5, дважды. Это был определенно неутешительный день. Я разговаривал с другим старшим фарангом в моей школе, Карлом, о моих младших учениках пятого класса. Он сказал мне, что знает, на что это похоже.

    Неисправность пусковой системы ford Taurus

    Wonder How To — это ваше руководство по бесплатному просмотру видео в Интернете.Ищите, просматривайте и узнавайте, как лучше всего размещать видео в Интернете, используя самый крупный способ индексирования видео в Интернете.

    northstar аудирование и говорение, уровень 4, третье издание руководство для учителей и тесты достижений 15 октября 2020 г. Автор: Robert Ludlum Ltd ТЕКСТ ID c920f044 Электронная книга в формате PDF Библиотека Epub

    Студенческая комната, Пересмотр и пометка учителями являются торговыми наименованиями Студента Регистрационный номер компании Room Group Ltd.: 04666380 (Англия и Уэльс), номер плательщика НДС 806 8067 22 Зарегистрированный офис: International House, Queens Road, Brighton, BN1 3XE

    Установка видеокарты Gigabyte

    Лежачий велосипед на продажу Craigslist

    Радио Bmw 745i включается и выключается

    Гуджаратская песня ди-джея

    Winchester 38 Special Brass

    Типы героев в мифологии

    Canpercent27t слышит одного друга на вечеринке ps4 2020

    9

    зарядное устройство для планшета

    Unraid Extended Smart Test

    Двоичное в десятичное в C ++ с использованием стека

    Обучение и обучение студентов, живущих в бедности

    Программное обеспечение Cricut бесплатно

    Калькулятор угла поворота ствола

    Звуковое приложение зуммера

    Коэффициент полета Bss a320 Ultimate Sound Pack

    blank удаляет вредные пары из лаборатории

    John deere 4045 замена переднего сальника коленчатого вала

    Synkoloid внешняя шпаклевочная паста sds

    6.

    Добавить комментарий

    Ваш адрес email не будет опубликован.